Mutagenetix > Incidental Mutation

Incidental Mutation 'R5566:Rpl31'

436775

Institutional Source

Beutler Lab

Gene Symbol

Rpl31

Ensembl Gene

ENSMUSG00000073702

Gene Name

ribosomal protein L31

Synonyms

MMRRC Submission

043123-MU

Accession Numbers

Essential gene?

Not available question?

Stock #

R5566 (G1)

Quality Score

154

Status

Not validated

Chromosome

Chromosomal Location

39367842-39371911 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 39370027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 41 (R41C)

Ref Sequence

ENSEMBL: ENSMUSP00000141808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000086535] [ENSMUST00000178079] [ENSMUST00000179954] [ENSMUST00000192531] [ENSMUST00000193823] [ENSMUST00000194746] [ENSMUST00000195123]

AlphaFold

P62900

Predicted Effect

probably benign
Transcript: ENSMUST00000054462

SMART Domains

Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134

Domain	Start	End	E-Value	Type
low complexity region	28	49	N/A	INTRINSIC
GRAM	145	212	3.6e-20	SMART
GRAM	285	353	2.77e-21	SMART
TBC	501	714	4.51e-54	SMART
Blast:TBC	726	923	1e-120	BLAST
coiled coil region	960	991	N/A	INTRINSIC
low complexity region	1030	1045	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086535
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000083722
Gene: ENSMUSG00000073702
AA Change: R41C

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:Ribosomal_L31e	18	101	3.1e-43	PFAM
low complexity region	102	113	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178079
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000136354
Gene: ENSMUSG00000073702
AA Change: R41C

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:Ribosomal_L31e	18	101	3.1e-43	PFAM
low complexity region	102	113	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179954
AA Change: R41C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000137631
Gene: ENSMUSG00000073702
AA Change: R41C

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:Ribosomal_L31e	18	101	3.1e-43	PFAM
low complexity region	102	113	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191855

Predicted Effect

probably benign
Transcript: ENSMUST00000192099

Predicted Effect

probably benign
Transcript: ENSMUST00000192531

SMART Domains

Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

Domain	Start	End	E-Value	Type
low complexity region	28	49	N/A	INTRINSIC
low complexity region	80	98	N/A	INTRINSIC
low complexity region	144	152	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193823

SMART Domains

Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134

Domain	Start	End	E-Value	Type
low complexity region	28	49	N/A	INTRINSIC
GRAM	145	212	1.2e-22	SMART
GRAM	285	353	9.6e-24	SMART
TBC	501	714	2.2e-56	SMART
Blast:TBC	726	923	1e-120	BLAST
coiled coil region	960	990	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194746
AA Change: R41C

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000141808
Gene: ENSMUSG00000073702
AA Change: R41C

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:Ribosomal_L31e	18	101	3.1e-40	PFAM
low complexity region	102	113	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195123
AA Change: R41C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000142039
Gene: ENSMUSG00000073702
AA Change: R41C

Domain	Start	End	E-Value	Type
low complexity region	5	13	N/A	INTRINSIC
Pfam:Ribosomal_L31e	18	83	7.9e-29	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Carriers of dominant spontaneous mutations have a shortened, kinked tail with variable expessivity in the tail length and number of kinks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,180,692	I26T	possibly damaging	Het
Abca13	T	A	11: 9,294,615	Y2159*	probably null	Het
Abca3	A	G	17: 24,383,927	T499A	probably benign	Het
Abcb5	T	A	12: 118,935,967	T322S	probably damaging	Het
Adamts4	T	A	1: 171,250,850	M1K	probably null	Het
Adamtsl4	C	T	3: 95,685,455		probably null	Het
Adh4	A	T	3: 138,424,189	I259F	probably damaging	Het
Aff3	G	A	1: 38,181,424	S1135F	probably damaging	Het
Arhgef16	T	C	4: 154,285,648	D280G	probably benign	Het
Baiap3	T	C	17: 25,251,733	E71G	probably damaging	Het
BC030867	T	A	11: 102,255,833	S312T	probably damaging	Het
Calb2	A	G	8: 110,152,700	I91T	possibly damaging	Het
Ccr5	A	G	9: 124,124,660	N100S	probably benign	Het
Cep57	G	T	9: 13,821,575	R25S	probably damaging	Het
Chadl	A	G	15: 81,695,878	L52P	probably damaging	Het
Clec12b	T	C	6: 129,385,475	T6A	probably damaging	Het
Cnga1	T	A	5: 72,618,250	N43Y	probably damaging	Het
Col20a1	A	T	2: 180,986,523		probably null	Het
Csmd2	T	C	4: 128,462,889		probably null	Het
Ctps	A	T	4: 120,554,103		probably null	Het
Cyp39a1	T	A	17: 43,685,208	W224R	possibly damaging	Het
Defb29	A	T	2: 152,538,928	Y54N	probably benign	Het
Dmbt1	A	T	7: 131,106,273	D1241V	probably damaging	Het
Dnah1	A	T	14: 31,274,366	I2671K	probably benign	Het
Dnah2	C	A	11: 69,516,569	E158*	probably null	Het
Edar	A	G	10: 58,628,641	S59P	possibly damaging	Het
Egr2	T	A	10: 67,540,766	C339*	probably null	Het
Eif5b	G	A	1: 38,045,684	V871I	possibly damaging	Het
Eif5b	G	A	1: 38,051,247	G1169E	probably damaging	Het
Erap1	A	G	13: 74,662,412	Y290C	probably damaging	Het
Fastkd5	T	A	2: 130,614,301	T790S	possibly damaging	Het
Fkrp	C	T	7: 16,810,924	V338M	probably damaging	Het
Gabra6	T	C	11: 42,307,490	T378A	probably benign	Het
Gm4924	C	A	10: 82,378,641	Q17K	possibly damaging	Het
Gm9847	A	G	12: 14,494,999		noncoding transcript	Het
Gpr108	A	G	17: 57,236,919	F429S	probably damaging	Het
Gpr162	G	A	6: 124,860,938	R250*	probably null	Het
Gtf2a1	A	T	12: 91,567,594	D295E	possibly damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Herc1	T	A	9: 66,465,537	M3125K	possibly damaging	Het
Hoxb6	T	A	11: 96,300,754	Y167*	probably null	Het
Htt	T	C	5: 34,849,075	Y1443H	probably damaging	Het
Il21r	A	G	7: 125,625,298	D28G	probably damaging	Het
Impact	T	G	18: 12,974,762	V29G	probably damaging	Het
Itpr3	A	G	17: 27,115,952	T2147A	possibly damaging	Het
Itsn2	T	A	12: 4,626,554	L50Q	probably damaging	Het
Jade1	A	G	3: 41,604,903	D473G	possibly damaging	Het
Kif26a	T	G	12: 112,157,354	L131R	probably damaging	Het
Kif2a	A	T	13: 106,993,924	M1K	probably null	Het
Lrsam1	C	A	2: 32,941,858	Q368H	probably damaging	Het
Macf1	T	C	4: 123,435,164	Q4592R	probably damaging	Het
Map3k5	T	C	10: 20,110,719	V893A	probably damaging	Het
Med13l	G	T	5: 118,728,665	V595F	possibly damaging	Het
Mocs1	T	A	17: 49,454,183	L435Q	possibly damaging	Het
Mtmr4	T	C	11: 87,604,530	L471P	probably damaging	Het
Myo7a	T	C	7: 98,064,816	E1616G	possibly damaging	Het
Nacad	T	A	11: 6,602,136	S352C	probably damaging	Het
Nfat5	T	A	8: 107,369,135	M817K	possibly damaging	Het
Ofcc1	C	A	13: 40,094,653	L668F	probably damaging	Het
Olfr1062	G	A	2: 86,423,377	Q100*	probably null	Het
Olfr18	T	C	9: 20,313,969	Q309R	probably benign	Het
Olfr527	C	A	7: 140,336,067	D68E	probably damaging	Het
Plxnb2	T	C	15: 89,164,020	T696A	probably benign	Het
Prkab2	T	A	3: 97,662,293	F58L	probably benign	Het
Prpf4	G	T	4: 62,415,969	L220F	probably benign	Het
Rad18	A	T	6: 112,681,346	D199E	probably benign	Het
Raet1e	T	C	10: 22,174,405	L29P	probably damaging	Het
Ralgapb	A	C	2: 158,494,710	T1089P	possibly damaging	Het
Rest	A	G	5: 77,282,326	E864G	probably benign	Het
Rgsl1	T	A	1: 153,793,774	I289F	probably damaging	Het
Rint1	T	C	5: 23,810,953	Y406H	probably damaging	Het
Scn8a	T	C	15: 100,974,534	S485P	probably damaging	Het
Slamf1	T	A	1: 171,787,970	V249E	possibly damaging	Het
Slc39a12	C	T	2: 14,407,603	T362I	possibly damaging	Het
Sos1	C	T	17: 80,453,890	V126I	possibly damaging	Het
Srcap	T	C	7: 127,525,303	F215S	probably damaging	Het
Supt4a	T	A	11: 87,743,287	S110T	probably benign	Het
Tbc1d30	T	A	10: 121,302,110	T232S	probably damaging	Het
Tctex1d2	A	G	16: 32,419,900	Y31C	probably damaging	Het
Tenm3	A	G	8: 48,279,006	C1288R	probably damaging	Het
Tespa1	T	A	10: 130,355,487	L100*	probably null	Het
Tgm1	C	A	14: 55,712,436	R105L	probably damaging	Het
Tgoln1	G	A	6: 72,616,035	T154I	possibly damaging	Het
Trp53i13	G	A	11: 77,508,726	T259I	probably damaging	Het
Tubgcp4	T	A	2: 121,184,770	F320I	possibly damaging	Het
Vmn1r21	A	C	6: 57,844,094	Y122D	probably benign	Het
Vmn1r75	T	A	7: 11,880,480	D46E	probably damaging	Het
Vmn2r120	A	T	17: 57,545,290	L9M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,823	I165T	possibly damaging	Het
Vmn2r76	A	T	7: 86,226,078	Y564N	probably damaging	Het
Wee1	G	T	7: 110,126,050	E300*	probably null	Het
Xdh	T	C	17: 73,893,622	D1168G	probably damaging	Het
Zcchc6	A	T	13: 59,788,629	C817*	probably null	Het
Zfp54	A	G	17: 21,433,444	T67A	probably damaging	Het
Zfp941	G	T	7: 140,812,766	H227N	probably benign	Het
Zpr1	T	A	9: 46,281,075	V399D	possibly damaging	Het
Zzz3	A	G	3: 152,455,824	E285G	probably damaging	Het

Other mutations in Rpl31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R4838:Rpl31	UTSW	1	39370967	missense	probably benign	0.03
R5567:Rpl31	UTSW	1	39370027	missense	probably benign	0.05
R5570:Rpl31	UTSW	1	39370027	missense	probably benign	0.05
R5580:Rpl31	UTSW	1	39370027	missense	probably benign	0.05
R5644:Rpl31	UTSW	1	39370027	missense	probably benign	0.05
R9767:Rpl31	UTSW	1	39371108	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TACTCTGGGAAAGTGAGCGG -3'
(R):5'- GCTAACTGAACTCTCAAATGTGACAC -3'

Sequencing Primer
(F):5'- CGGGACATCTTGAACTATAGGATGC -3'
(R):5'- CACACACACACTATATAAGGAATTGG -3'

Posted On

2016-10-24