Incidental Mutation 'R5625:Abcg4'
ID441808
Institutional Source Beutler Lab
Gene Symbol Abcg4
Ensembl Gene ENSMUSG00000032131
Gene NameATP binding cassette subfamily G member 4
Synonyms6430517O04Rik
MMRRC Submission 043164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44273188-44288615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44278036 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 388 (D388A)
Ref Sequence ENSEMBL: ENSMUSP00000124647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034648] [ENSMUST00000160384] [ENSMUST00000161354] [ENSMUST00000161408] [ENSMUST00000162783]
Predicted Effect probably benign
Transcript: ENSMUST00000034648
AA Change: D388A

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034648
Gene: ENSMUSG00000032131
AA Change: D388A

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 1.6e-49 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160323
Predicted Effect probably benign
Transcript: ENSMUST00000160384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161206
Predicted Effect probably benign
Transcript: ENSMUST00000161354
AA Change: D388A

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124647
Gene: ENSMUSG00000032131
AA Change: D388A

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 4.8e-47 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161408
Predicted Effect probably benign
Transcript: ENSMUST00000162783
SMART Domains Protein: ENSMUSP00000123999
Gene: ENSMUSG00000032131

DomainStartEndE-ValueType
Blast:AAA 1 37 9e-20 BLAST
SCOP:d1gcya2 33 64 1e-2 SMART
Meta Mutation Damage Score 0.8321 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein is a member of the White subfamily and plays an important role in cellular cholesterol homeostasis. This protein functions as either a homodimer or as a heterodimer with another ABC subfamily protein such as ABCG1. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a report allele exhibit increased brain lathosterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Uggt2 A G 14: 119,077,724 I311T probably damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Abcg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Abcg4 APN 9 44275142 splice site probably benign
IGL00585:Abcg4 APN 9 44281623 missense probably benign 0.04
IGL02016:Abcg4 APN 9 44287350 missense probably damaging 0.99
IGL02085:Abcg4 APN 9 44281557 critical splice donor site probably null
IGL02142:Abcg4 APN 9 44277717 missense probably benign 0.18
IGL02171:Abcg4 APN 9 44275009 unclassified probably benign
IGL02309:Abcg4 APN 9 44281828 missense probably benign 0.21
IGL02882:Abcg4 APN 9 44277489 nonsense probably null
R0009:Abcg4 UTSW 9 44277649 splice site probably benign
R0023:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R0481:Abcg4 UTSW 9 44279369 missense probably benign 0.07
R0513:Abcg4 UTSW 9 44281687 missense possibly damaging 0.61
R0644:Abcg4 UTSW 9 44274699 missense possibly damaging 0.87
R0649:Abcg4 UTSW 9 44278033 missense probably benign 0.00
R1084:Abcg4 UTSW 9 44277469 missense probably benign 0.27
R1518:Abcg4 UTSW 9 44275369 missense probably benign 0.05
R1528:Abcg4 UTSW 9 44274723 missense probably damaging 0.99
R1702:Abcg4 UTSW 9 44275073 missense probably damaging 0.99
R1932:Abcg4 UTSW 9 44279394 missense probably benign 0.16
R4477:Abcg4 UTSW 9 44275086 missense probably damaging 1.00
R4661:Abcg4 UTSW 9 44287330 missense probably damaging 1.00
R4883:Abcg4 UTSW 9 44279319 missense probably damaging 1.00
R4901:Abcg4 UTSW 9 44277657 critical splice donor site probably null
R5039:Abcg4 UTSW 9 44281566 missense probably damaging 1.00
R5209:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R5329:Abcg4 UTSW 9 44279545 missense probably benign 0.00
R5492:Abcg4 UTSW 9 44278058 missense probably benign 0.01
R5521:Abcg4 UTSW 9 44279683 unclassified probably benign
R5558:Abcg4 UTSW 9 44281408 missense probably damaging 0.99
R6318:Abcg4 UTSW 9 44275348 missense probably benign
R7060:Abcg4 UTSW 9 44275128 missense probably benign 0.13
R7129:Abcg4 UTSW 9 44279384 missense probably benign 0.03
R7431:Abcg4 UTSW 9 44274700 missense possibly damaging 0.87
R7452:Abcg4 UTSW 9 44279600 missense probably damaging 1.00
X0028:Abcg4 UTSW 9 44274634 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACATGAACCGCAAGTGGGTC -3'
(R):5'- CATCTACTGAGCTGGATGGG -3'

Sequencing Primer
(F):5'- AAATGTGTGTTTCAGGCCAAG -3'
(R):5'- CTACTGAGCTGGATGGGCAGTG -3'
Posted On2016-11-08