Incidental Mutation 'R5625:Uggt2'
ID441818
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene NameUDP-glucose glycoprotein glucosyltransferase 2
Synonyms3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik
MMRRC Submission 043164-MU
Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5625 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location118985039-119099430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119077724 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 311 (I311T)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156203]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136924
Predicted Effect probably damaging
Transcript: ENSMUST00000156203
AA Change: I311T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: I311T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Meta Mutation Damage Score 0.6375 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T G 9: 44,278,036 D388A probably benign Het
Ampd3 A C 7: 110,802,523 E408A probably damaging Het
BC027072 T A 17: 71,751,326 D452V probably damaging Het
Bmp1 G T 14: 70,486,166 N743K probably benign Het
Brsk1 A G 7: 4,706,400 K398E probably damaging Het
Ccdc157 A T 11: 4,151,888 M11K probably damaging Het
Cep295 A C 9: 15,340,891 M394R probably damaging Het
Cfap44 G T 16: 44,460,347 probably null Het
Col13a1 C T 10: 61,843,609 G713R unknown Het
Cxcr2 A T 1: 74,158,832 K162* probably null Het
Cyp3a44 C T 5: 145,779,566 D405N possibly damaging Het
Exo1 G T 1: 175,893,814 D340Y possibly damaging Het
Farp2 T G 1: 93,528,748 L51R probably damaging Het
Fat4 A T 3: 38,888,934 I659F possibly damaging Het
Gbp2b T A 3: 142,599,045 W81R probably damaging Het
Gipc2 C T 3: 152,165,904 probably benign Het
Gm10941 G T 10: 77,258,836 probably benign Het
Gm1988 A T 7: 39,173,805 noncoding transcript Het
Hapln3 G T 7: 79,117,258 probably null Het
Ifi213 A G 1: 173,569,063 S482P possibly damaging Het
Insc A G 7: 114,829,067 T92A probably damaging Het
Lrrn1 T A 6: 107,567,354 C38S probably damaging Het
Mycbpap T C 11: 94,505,693 E107G probably damaging Het
Neb A T 2: 52,177,535 L5848* probably null Het
Nrg3 A T 14: 38,370,993 M545K probably damaging Het
Nudt3 A G 17: 27,583,228 L28P probably damaging Het
Olfr955 T A 9: 39,469,803 M308L probably benign Het
Otop1 A T 5: 38,302,761 Y557F probably damaging Het
Pdgfra G A 5: 75,189,337 probably null Het
Pi4kb A G 3: 94,984,677 M223V probably benign Het
Piezo1 T C 8: 122,482,960 T2335A probably benign Het
Ppp6c A G 2: 39,197,441 V251A probably benign Het
Prkg1 C T 19: 31,764,762 E21K possibly damaging Het
Ptpru T C 4: 131,803,380 E521G probably null Het
Rasl10b G T 11: 83,418,814 R199L probably damaging Het
Rhbdf2 G A 11: 116,605,377 R111C probably damaging Het
Sec23ip G T 7: 128,744,983 probably benign Het
Sptbn5 A T 2: 120,079,792 noncoding transcript Het
Srsf11 C T 3: 158,023,344 probably benign Het
Syne2 T C 12: 76,095,112 S6141P probably benign Het
Szt2 A G 4: 118,373,217 V2653A unknown Het
Tex46 T C 4: 136,610,614 F39S probably damaging Het
Tmem50a AACCA AA 4: 134,898,467 probably benign Het
Tmem62 G T 2: 120,990,393 W180L probably damaging Het
Tnxb G A 17: 34,685,211 A1232T probably benign Het
Tubgcp3 T C 8: 12,624,888 H744R possibly damaging Het
Usp8 C T 2: 126,742,277 R469C probably damaging Het
Vmn1r19 T C 6: 57,405,296 L278S probably damaging Het
Vmn2r59 A T 7: 42,046,460 I176N probably benign Het
Vmn2r-ps159 A T 4: 156,334,210 noncoding transcript Het
Wdr93 A G 7: 79,771,018 T376A probably benign Het
Zfp575 G A 7: 24,585,652 A188V possibly damaging Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119049276 missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119026429 nonsense probably null
IGL00433:Uggt2 APN 14 119013487 missense probably benign
IGL00572:Uggt2 APN 14 119042791 missense probably benign 0.02
IGL00577:Uggt2 APN 14 119034900 missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119042799 missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119057645 missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119042772 missense probably benign 0.00
IGL01787:Uggt2 APN 14 119081734 missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119089193 missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119090738 missense probably benign 0.17
IGL02894:Uggt2 APN 14 119081799 missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119075346 missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119095310 missense probably benign 0.25
IGL03142:Uggt2 APN 14 118998191 missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119077668 missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119070888 missense probably benign 0.38
P0014:Uggt2 UTSW 14 119044538 missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119049663 missense probably benign 0.07
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0383:Uggt2 UTSW 14 119049451 missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119075329 critical splice donor site probably null
R0472:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119057598 missense probably benign 0.27
R0788:Uggt2 UTSW 14 119095400 splice site probably benign
R0940:Uggt2 UTSW 14 119091192 critical splice donor site probably null
R1567:Uggt2 UTSW 14 119009093 missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119057663 missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119054643 missense probably benign 0.19
R1746:Uggt2 UTSW 14 119013503 missense probably benign 0.00
R1785:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119032276 missense probably benign 0.00
R1894:Uggt2 UTSW 14 119049718 missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119008055 splice site probably benign
R2149:Uggt2 UTSW 14 119075345 missense probably benign 0.02
R2168:Uggt2 UTSW 14 119019505 missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2240:Uggt2 UTSW 14 118995049 missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119026599 missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119059109 missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2907:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2908:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2998:Uggt2 UTSW 14 119049385 missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119091270 missense probably benign 0.39
R3722:Uggt2 UTSW 14 119041518 missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119057672 missense probably benign 0.13
R4015:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119049262 missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119019558 missense probably benign
R4642:Uggt2 UTSW 14 119034935 missense probably benign 0.00
R4654:Uggt2 UTSW 14 119032258 missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119029054 splice site probably null
R4810:Uggt2 UTSW 14 119013521 missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119001847 missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119035964 splice site probably null
R4886:Uggt2 UTSW 14 119035964 splice site probably null
R4888:Uggt2 UTSW 14 119049253 missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119077650 critical splice donor site probably null
R4895:Uggt2 UTSW 14 119018886 missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119081770 missense probably benign 0.00
R5423:Uggt2 UTSW 14 119019486 missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119090709 missense probably benign 0.01
R5561:Uggt2 UTSW 14 119041527 missense probably benign 0.02
R5607:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5698:Uggt2 UTSW 14 119042726 missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119049426 missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6056:Uggt2 UTSW 14 119035969 critical splice donor site probably null
R6289:Uggt2 UTSW 14 119041602 missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119057564 missense probably benign 0.01
R6515:Uggt2 UTSW 14 119077719 missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119070881 missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119042610 missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119026435 missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119001859 missense probably benign 0.10
R7117:Uggt2 UTSW 14 119014526 missense probably benign 0.25
R7183:Uggt2 UTSW 14 119019637 splice site probably null
R7337:Uggt2 UTSW 14 119086175 missense probably benign 0.28
R7342:Uggt2 UTSW 14 118994972 missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119089269 missense probably benign 0.12
R7625:Uggt2 UTSW 14 119026493 missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119075347 missense probably damaging 1.00
R7842:Uggt2 UTSW 14 118998104 missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119042647 missense probably benign 0.09
R7938:Uggt2 UTSW 14 119059107 missense possibly damaging 0.68
R8050:Uggt2 UTSW 14 119026422 missense probably damaging 0.98
Z1177:Uggt2 UTSW 14 119007296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATATTGGGCACTACTGTGAATAC -3'
(R):5'- GAAGCCAGAGTATCTGTGTTTGC -3'

Sequencing Primer
(F):5'- AAGAGTCCTGAAGTTTGAAAAGC -3'
(R):5'- TCATTCATAAAAGTCTAAGTCGTACC -3'
Posted On2016-11-08