Incidental Mutation 'R5794:Napepld'
ID447113
Institutional Source Beutler Lab
Gene Symbol Napepld
Ensembl Gene ENSMUSG00000044968
Gene NameN-acyl phosphatidylethanolamine phospholipase D
SynonymsNAPE-PLD
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21662901-21701396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21683431 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 7 (S7C)
Ref Sequence ENSEMBL: ENSMUSP00000110872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060899] [ENSMUST00000115217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060899
AA Change: S7C

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054458
Gene: ENSMUSG00000044968
AA Change: S7C

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.5e-14 PFAM
Pfam:Lactamase_B_2 142 344 2.7e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115217
AA Change: S7C

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110872
Gene: ENSMUSG00000044968
AA Change: S7C

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.3e-13 PFAM
Pfam:Lactamase_B_2 142 344 1.4e-39 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NAPEPLD is a phospholipase D type enzyme that catalyzes the release of N-acylethanolamine (NAE) from N-acyl-phosphatidylethanolamine (NAPE) in the second step of the biosynthesis of N-acylethanolamine (Okamoto et al., 2004 [PubMed 14634025]).[supplied by OMIM, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and healthy, but have abnormal brain levels of N-acyl ethanolamines and N-acyl phosphatidylethanolamines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Napepld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Napepld APN 5 21683193 missense probably benign 0.11
IGL01659:Napepld APN 5 21675716 missense probably damaging 0.99
IGL01726:Napepld APN 5 21675659 missense possibly damaging 0.93
IGL02083:Napepld APN 5 21676067 missense probably damaging 1.00
IGL02425:Napepld APN 5 21683442 missense probably benign 0.19
R1763:Napepld UTSW 5 21683410 missense probably benign 0.00
R1903:Napepld UTSW 5 21665272 missense probably damaging 0.97
R2166:Napepld UTSW 5 21683232 missense possibly damaging 0.48
R3861:Napepld UTSW 5 21683289 missense probably benign 0.32
R4899:Napepld UTSW 5 21683440 missense probably benign 0.00
R5629:Napepld UTSW 5 21675903 missense probably benign 0.01
R6273:Napepld UTSW 5 21665322 missense probably benign 0.01
R7619:Napepld UTSW 5 21675848 missense probably damaging 1.00
R7810:Napepld UTSW 5 21683265 missense possibly damaging 0.86
R7846:Napepld UTSW 5 21675723 missense probably benign 0.13
R7852:Napepld UTSW 5 21683173 missense probably benign 0.00
R8050:Napepld UTSW 5 21665321 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGCACATTCGGGATGGAG -3'
(R):5'- GTTTTGCAGCCAGAAGTTTTGAATC -3'

Sequencing Primer
(F):5'- GTTGGCCATGGGTTAACAAATCTCC -3'
(R):5'- GCAGCCAGAAGTTTTGAATCAATAC -3'
Posted On2016-12-15