Incidental Mutation 'R5794:Fbxw20'
ID447125
Institutional Source Beutler Lab
Gene Symbol Fbxw20
Ensembl Gene ENSMUSG00000061701
Gene NameF-box and WD-40 domain protein 20
Synonyms
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109217432-109234754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109223290 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 325 (N325S)
Ref Sequence ENSEMBL: ENSMUSP00000078503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079548] [ENSMUST00000197329]
Predicted Effect probably damaging
Transcript: ENSMUST00000079548
AA Change: N325S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078503
Gene: ENSMUSG00000061701
AA Change: N325S

DomainStartEndE-ValueType
FBOX 5 45 2.37e-6 SMART
SCOP:d1tbga_ 116 249 5e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197329
AA Change: N255S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143126
Gene: ENSMUSG00000061701
AA Change: N255S

DomainStartEndE-ValueType
FBOX 5 45 1.5e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198261
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Olfr996 T C 2: 85,579,341 V34A probably benign Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Fbxw20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Fbxw20 APN 9 109234702 start codon destroyed probably damaging 0.97
IGL01764:Fbxw20 APN 9 109223359 missense possibly damaging 0.71
IGL02149:Fbxw20 APN 9 109233818 critical splice donor site probably null
IGL02307:Fbxw20 APN 9 109233533 missense possibly damaging 0.70
IGL02335:Fbxw20 APN 9 109223309 missense possibly damaging 0.91
IGL02338:Fbxw20 APN 9 109225978 missense probably benign 0.00
PIT4377001:Fbxw20 UTSW 9 109221727 missense probably benign 0.00
PIT4434001:Fbxw20 UTSW 9 109223432 missense probably damaging 1.00
R0652:Fbxw20 UTSW 9 109232332 missense probably damaging 1.00
R1018:Fbxw20 UTSW 9 109221336 missense probably benign 0.03
R1114:Fbxw20 UTSW 9 109223482 missense probably damaging 1.00
R1596:Fbxw20 UTSW 9 109221300 missense probably damaging 1.00
R1692:Fbxw20 UTSW 9 109221709 missense possibly damaging 0.73
R1967:Fbxw20 UTSW 9 109217510 missense probably benign 0.00
R2055:Fbxw20 UTSW 9 109221374 missense probably damaging 0.99
R2224:Fbxw20 UTSW 9 109233582 missense possibly damaging 0.50
R4394:Fbxw20 UTSW 9 109232330 missense probably benign 0.00
R4617:Fbxw20 UTSW 9 109217563 missense probably damaging 1.00
R4858:Fbxw20 UTSW 9 109234695 missense possibly damaging 0.54
R5794:Fbxw20 UTSW 9 109233600 missense possibly damaging 0.95
R6090:Fbxw20 UTSW 9 109223363 missense probably benign 0.03
R7161:Fbxw20 UTSW 9 109225980 missense probably damaging 1.00
R7328:Fbxw20 UTSW 9 109232315 missense probably damaging 1.00
R8004:Fbxw20 UTSW 9 109221381 missense probably damaging 1.00
R8258:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
R8259:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
Z1177:Fbxw20 UTSW 9 109225887 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTGTACGTATGCATGTGTACAA -3'
(R):5'- GCCAGGCTGCAGAGATTTAC -3'

Sequencing Primer
(F):5'- CGTATGCATGTGTACAAGCTAAACC -3'
(R):5'- CTGCAGGTCGTTTACATGAACAGC -3'
Posted On2016-12-15