Incidental Mutation 'R5794:Olfr996'
ID447108
Institutional Source Beutler Lab
Gene Symbol Olfr996
Ensembl Gene ENSMUSG00000111179
Gene Nameolfactory receptor 996
SynonymsGA_x6K02T2Q125-47058060-47059004, MOR175-4
MMRRC Submission 043385-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R5794 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85579215-85580282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85579341 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 34 (V34A)
Ref Sequence ENSEMBL: ENSMUSP00000076330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077075]
Predicted Effect probably benign
Transcript: ENSMUST00000077075
AA Change: V34A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000076330
Gene: ENSMUSG00000111179
AA Change: V34A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-52 PFAM
Pfam:7tm_1 41 290 2.7e-16 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph T C 11: 20,726,955 probably null Het
Ank2 T C 3: 126,930,020 N923S probably benign Het
Ano6 A T 15: 95,894,524 T76S probably benign Het
Carmil1 G T 13: 24,092,550 N204K probably damaging Het
Cep126 T G 9: 8,103,439 N190T possibly damaging Het
Clasrp A T 7: 19,591,109 D198E probably damaging Het
Cma1 T C 14: 55,944,520 T18A probably benign Het
Ece1 A G 4: 137,956,533 I565M probably damaging Het
Etl4 T A 2: 20,806,512 F1135L probably damaging Het
Fbxw20 T C 9: 109,223,290 N325S probably damaging Het
Fbxw20 A T 9: 109,233,600 C53S possibly damaging Het
Gnb2 T C 5: 137,528,699 D203G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hoxd9 T A 2: 74,699,273 F291Y probably damaging Het
Igf2r T C 17: 12,709,445 S1004G probably benign Het
Irgm1 T C 11: 48,866,237 Y249C probably damaging Het
Kcnh3 A C 15: 99,232,974 I491L probably benign Het
Kctd10 G A 5: 114,367,337 R199W probably damaging Het
Klk1b4 A T 7: 44,209,645 N29I probably damaging Het
Klrc1 C T 6: 129,675,354 R188Q probably damaging Het
Krt32 C A 11: 100,084,986 C275F probably damaging Het
Krt73 T A 15: 101,794,829 T449S probably benign Het
Napepld T A 5: 21,683,431 S7C possibly damaging Het
Nfia G T 4: 97,783,601 V183L possibly damaging Het
Olfr788 A C 10: 129,473,426 I245L possibly damaging Het
Psma3 A G 12: 70,990,497 T111A probably benign Het
Psmd11 T A 11: 80,471,492 D125E probably benign Het
Rabgap1 T A 2: 37,502,902 D523E probably benign Het
Rttn G T 18: 88,995,569 R454L probably benign Het
Serpine2 T C 1: 79,821,439 N33D probably benign Het
Six4 A T 12: 73,112,350 S271T possibly damaging Het
Smoc2 T A 17: 14,369,048 C260S possibly damaging Het
Snai2 A T 16: 14,706,726 Y32F probably benign Het
Tapt1 C T 5: 44,177,134 G505D probably benign Het
Thap12 T A 7: 98,716,393 D589E probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r116 T C 17: 23,385,968 I85T probably damaging Het
Zfp592 G T 7: 81,025,033 V582L probably benign Het
Zfp827 T C 8: 79,070,442 W386R probably damaging Het
Other mutations in Olfr996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Olfr996 APN 2 85579531 nonsense probably null
IGL01972:Olfr996 APN 2 85579773 missense probably damaging 1.00
IGL02102:Olfr996 APN 2 85579673 missense probably damaging 0.98
IGL03159:Olfr996 APN 2 85579940 missense probably damaging 0.99
R0539:Olfr996 UTSW 2 85579775 missense probably damaging 0.99
R4275:Olfr996 UTSW 2 85579863 missense probably benign 0.07
R4561:Olfr996 UTSW 2 85579620 missense probably damaging 0.99
R4953:Olfr996 UTSW 2 85579725 nonsense probably null
R6061:Olfr996 UTSW 2 85579542 missense possibly damaging 0.48
R6695:Olfr996 UTSW 2 85579449 missense probably damaging 1.00
R6981:Olfr996 UTSW 2 85579481 missense probably benign 0.06
R7030:Olfr996 UTSW 2 85579402 missense possibly damaging 0.56
R7399:Olfr996 UTSW 2 85579296 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGACCTACTGCCACTGATTTC -3'
(R):5'- CCAAAGAACCACATCTGTGCTG -3'

Sequencing Primer
(F):5'- GACCTACTGCCACTGATTTCATAATC -3'
(R):5'- CCCACAAAAGAGATGGCTTTGTTC -3'
Posted On2016-12-15