Incidental Mutation 'R5775:Sec61a2'
ID448704
Institutional Source Beutler Lab
Gene Symbol Sec61a2
Ensembl Gene ENSMUSG00000025816
Gene NameSec61, alpha subunit 2 (S. cerevisiae)
Synonyms
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5870987-5895432 bp(-) (GRCm38)
Type of Mutationintron (44 bp from exon)
DNA Base Change (assembly) A to T at 5882774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026926] [ENSMUST00000026926] [ENSMUST00000102981] [ENSMUST00000193792]
Predicted Effect probably null
Transcript: ENSMUST00000026926
SMART Domains Protein: ENSMUSP00000026926
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.9e-24 PFAM
Pfam:SecY 75 162 1.2e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000026926
SMART Domains Protein: ENSMUSP00000026926
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.9e-24 PFAM
Pfam:SecY 75 162 1.2e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102981
SMART Domains Protein: ENSMUSP00000100046
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.2e-21 PFAM
Pfam:SecY 75 458 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148745
Predicted Effect probably null
Transcript: ENSMUST00000193792
SMART Domains Protein: ENSMUSP00000141333
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 4e-22 PFAM
Pfam:SecY 75 263 5.3e-44 PFAM
Pfam:SecY 261 393 1.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194565
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to a mouse protein which suggests a role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. It may also be required for the assembly of membrane and secretory proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Sec61a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Sec61a2 APN 2 5872020 missense possibly damaging 0.93
IGL01690:Sec61a2 APN 2 5886552 missense possibly damaging 0.57
IGL01999:Sec61a2 APN 2 5891363 splice site probably benign
IGL02608:Sec61a2 APN 2 5874262 missense probably benign 0.01
IGL03131:Sec61a2 APN 2 5882878 nonsense probably null
IGL03271:Sec61a2 APN 2 5882934 nonsense probably null
IGL03294:Sec61a2 APN 2 5876465 unclassified probably null
R0413:Sec61a2 UTSW 2 5876354 intron probably benign
R0742:Sec61a2 UTSW 2 5876548 missense probably benign 0.01
R1659:Sec61a2 UTSW 2 5886534 missense possibly damaging 0.91
R1929:Sec61a2 UTSW 2 5873736 splice site probably benign
R2680:Sec61a2 UTSW 2 5873745 missense probably benign 0.00
R3522:Sec61a2 UTSW 2 5893216 missense probably benign 0.00
R3788:Sec61a2 UTSW 2 5879625 utr 3 prime probably null
R4405:Sec61a2 UTSW 2 5882859 missense probably benign 0.40
R4660:Sec61a2 UTSW 2 5873693 intron probably benign
R5387:Sec61a2 UTSW 2 5882545 intron probably benign
R5530:Sec61a2 UTSW 2 5882650 nonsense probably null
R5546:Sec61a2 UTSW 2 5876540 missense possibly damaging 0.78
R5922:Sec61a2 UTSW 2 5874323 missense possibly damaging 0.82
R5937:Sec61a2 UTSW 2 5886557 missense probably benign 0.00
R6681:Sec61a2 UTSW 2 5876408 nonsense probably null
R7499:Sec61a2 UTSW 2 5877914 missense probably benign 0.37
R7564:Sec61a2 UTSW 2 5882604 missense probably benign
Z1177:Sec61a2 UTSW 2 5886565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAAGGAGACAGATCCCAGC -3'
(R):5'- AGGATGCTCTGAACTGAAGTG -3'

Sequencing Primer
(F):5'- AGCACCCATTTCCGCAG -3'
(R):5'- TTATAGGAACATTGATGGAATTGGG -3'
Posted On2016-12-15