Incidental Mutation 'R5869:Nat8f6'
ID 454324
Institutional Source Beutler Lab
Gene Symbol Nat8f6
Ensembl Gene ENSMUSG00000079495
Gene Name N-acetyltransferase 8 (GCN5-related) family member 6
Synonyms Gm11128
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock # R5869 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 85808024-85820954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 85808523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 215 (L215V)
Ref Sequence ENSEMBL: ENSMUSP00000133846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087656] [ENSMUST00000174143]
AlphaFold Q9JIY8
Predicted Effect possibly damaging
Transcript: ENSMUST00000087656
AA Change: L215V

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084938
Gene: ENSMUSG00000079495
AA Change: L215V

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:Acetyltransf_10 71 193 5.5e-11 PFAM
Pfam:Acetyltransf_4 75 202 1.1e-9 PFAM
Pfam:Acetyltransf_7 105 195 1.2e-10 PFAM
Pfam:Acetyltransf_1 112 194 2.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161983
Predicted Effect possibly damaging
Transcript: ENSMUST00000174143
AA Change: L215V

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133846
Gene: ENSMUSG00000079495
AA Change: L215V

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:Acetyltransf_10 71 193 5.5e-11 PFAM
Pfam:Acetyltransf_4 75 202 1.1e-9 PFAM
Pfam:Acetyltransf_7 105 195 1.2e-10 PFAM
Pfam:Acetyltransf_1 112 194 2.6e-14 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Nat8f6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03087:Nat8f6 APN 6 85808517 missense probably damaging 1.00
R5988:Nat8f6 UTSW 6 85809058 missense probably benign 0.03
R6894:Nat8f6 UTSW 6 85808522 nonsense probably null
R7444:Nat8f6 UTSW 6 85809130 missense probably benign 0.02
R8375:Nat8f6 UTSW 6 85808906 missense probably benign 0.00
R8524:Nat8f6 UTSW 6 85808559 missense probably benign 0.34
R9231:Nat8f6 UTSW 6 85808648 missense probably damaging 0.99
Z1177:Nat8f6 UTSW 6 85808726 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGAGTAACCATTGCCCCAAG -3'
(R):5'- GTGTCATTGCAGCACCGAAG -3'

Sequencing Primer
(F):5'- ATTGCCCCAAGCCCACC -3'
(R):5'- GAAAGCTATGGTCAGGACTGTCC -3'
Posted On 2017-02-10