Incidental Mutation 'R5869:Mmp12'
ID490493
Institutional Source Beutler Lab
Gene Symbol Mmp12
Ensembl Gene ENSMUSG00000049723
Gene Namematrix metallopeptidase 12
SynonymsMmel, macrophage elastase, MMP12
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5869 (G1)
Quality Score122
Status Not validated
Chromosome9
Chromosomal Location7344381-7369499 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GTAATAATAATAATAATAAT to GTAATAATAATAATAAT at 7348446 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005950] [ENSMUST00000065079] [ENSMUST00000120655] [ENSMUST00000127722] [ENSMUST00000150167]
Predicted Effect probably benign
Transcript: ENSMUST00000005950
SMART Domains Protein: ENSMUSP00000005950
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PG_binding_1 30 91 7.6e-22 PFAM
ZnMc 109 268 2.76e-57 SMART
low complexity region 269 284 N/A INTRINSIC
HX 292 334 1.44e-6 SMART
HX 336 379 2.03e-6 SMART
HX 384 431 2.29e-14 SMART
HX 433 473 2.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065079
SMART Domains Protein: ENSMUSP00000065291
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
Pfam:PG_binding_1 30 91 6.5e-22 PFAM
ZnMc 109 268 1.23e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120655
SMART Domains Protein: ENSMUSP00000114129
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
Pfam:PG_binding_1 1 21 9.1e-9 PFAM
ZnMc 39 198 2.76e-57 SMART
low complexity region 199 214 N/A INTRINSIC
HX 222 264 1.44e-6 SMART
HX 266 309 2.03e-6 SMART
HX 314 361 2.29e-14 SMART
HX 363 403 2.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127722
SMART Domains Protein: ENSMUSP00000120225
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148005
Predicted Effect probably benign
Transcript: ENSMUST00000150167
SMART Domains Protein: ENSMUSP00000116080
Gene: ENSMUSG00000049723

DomainStartEndE-ValueType
Pfam:PG_binding_1 1 21 7.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein have a diminished capacity to degrade extracellular matrix components, do not develop emphysema in response to long-term exposure to cigarette smoke, and exhibit impaired clearance and increased mortality upon bacterial infection. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to cigarette smoke, decreased littler size, abnormal myelination, abnormal macrophage physiology, and decreased oligodedrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Mmp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mmp12 APN 9 7358307 missense possibly damaging 0.57
IGL03047:Mmp12 APN 9 7357797 splice site probably benign
IGL03224:Mmp12 APN 9 7350002 unclassified probably benign
IGL03247:Mmp12 APN 9 7348631 missense probably benign 0.05
R0050:Mmp12 UTSW 9 7350152 unclassified probably benign
R0480:Mmp12 UTSW 9 7350016 missense probably damaging 1.00
R0729:Mmp12 UTSW 9 7358290 missense possibly damaging 0.82
R0800:Mmp12 UTSW 9 7357827 missense possibly damaging 0.74
R1114:Mmp12 UTSW 9 7358289 missense possibly damaging 0.69
R1441:Mmp12 UTSW 9 7354787 missense probably damaging 0.98
R1765:Mmp12 UTSW 9 7354772 missense probably damaging 1.00
R2071:Mmp12 UTSW 9 7349725 missense probably damaging 1.00
R2102:Mmp12 UTSW 9 7349802 missense probably damaging 1.00
R2882:Mmp12 UTSW 9 7358236 missense probably damaging 1.00
R2936:Mmp12 UTSW 9 7357819 missense probably benign
R4645:Mmp12 UTSW 9 7347515 missense probably benign 0.04
R5210:Mmp12 UTSW 9 7349729 nonsense probably null
R5499:Mmp12 UTSW 9 7353000 missense probably benign 0.02
R5774:Mmp12 UTSW 9 7354823 missense possibly damaging 0.84
R5778:Mmp12 UTSW 9 7350106 missense probably damaging 1.00
R5841:Mmp12 UTSW 9 7347501 missense possibly damaging 0.93
R6044:Mmp12 UTSW 9 7350050 missense possibly damaging 0.94
R6494:Mmp12 UTSW 9 7353479 missense probably damaging 0.99
R6651:Mmp12 UTSW 9 7355345 missense possibly damaging 0.62
R7057:Mmp12 UTSW 9 7357840 missense probably damaging 1.00
R7057:Mmp12 UTSW 9 7369173 missense probably benign 0.33
X0062:Mmp12 UTSW 9 7353013 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAAGTACCCGTATATACTAGATGC -3'
(R):5'- GAACTGCTGCATTTCCTGGAG -3'

Sequencing Primer
(F):5'- GATGCTAAAATGGCTCCTTAAAAACC -3'
(R):5'- ATTGGAATTCTGTCCTTTCCATAATC -3'
Posted On2017-10-20