Incidental Mutation 'R5869:Tnfrsf19'
ID 454353
Institutional Source Beutler Lab
Gene Symbol Tnfrsf19
Ensembl Gene ENSMUSG00000060548
Gene Name tumor necrosis factor receptor superfamily, member 19
Synonyms TRADE, Troy, TAJ-ALPHA, TAJ
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5869 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 60963875-61046490 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60971178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 298 (R298H)
Ref Sequence ENSEMBL: ENSMUSP00000106867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111234] [ENSMUST00000111236] [ENSMUST00000224371] [ENSMUST00000225730]
AlphaFold Q9JLL3
Predicted Effect possibly damaging
Transcript: ENSMUST00000111234
AA Change: R298H

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106865
Gene: ENSMUSG00000060548
AA Change: R298H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111236
AA Change: R298H

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106867
Gene: ENSMUSG00000060548
AA Change: R298H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225501
Predicted Effect probably benign
Transcript: ENSMUST00000225730
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit no obvious physical abnormalities or alterations in behavior, locomotion, or fecundity, however neurons are more resistant to the suppressive action of myelin inhibitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Tnfrsf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Tnfrsf19 APN 14 61024182 missense possibly damaging 0.53
IGL01564:Tnfrsf19 APN 14 60974609 missense possibly damaging 0.85
IGL01878:Tnfrsf19 APN 14 60996644 missense probably damaging 0.98
IGL02220:Tnfrsf19 APN 14 60973492 unclassified probably benign
IGL02378:Tnfrsf19 APN 14 60971002 missense probably benign 0.00
IGL02546:Tnfrsf19 APN 14 60973538 missense possibly damaging 0.86
IGL02583:Tnfrsf19 APN 14 61024210 missense probably damaging 0.98
IGL03037:Tnfrsf19 APN 14 61024272 missense possibly damaging 0.83
IGL03221:Tnfrsf19 APN 14 61024778 missense probably benign 0.06
R0241:Tnfrsf19 UTSW 14 60973592 missense possibly damaging 0.93
R0373:Tnfrsf19 UTSW 14 60972036 missense possibly damaging 0.47
R1521:Tnfrsf19 UTSW 14 61005106 missense probably damaging 0.99
R3038:Tnfrsf19 UTSW 14 60972063 missense probably benign
R4346:Tnfrsf19 UTSW 14 60971980 critical splice donor site probably null
R4997:Tnfrsf19 UTSW 14 60971209 missense probably benign
R5756:Tnfrsf19 UTSW 14 61024775 missense probably benign
R6110:Tnfrsf19 UTSW 14 60971139 missense probably benign 0.08
R7047:Tnfrsf19 UTSW 14 61005218 nonsense probably null
R7266:Tnfrsf19 UTSW 14 60974698 missense possibly damaging 0.91
R7491:Tnfrsf19 UTSW 14 61005205 missense possibly damaging 0.75
R7729:Tnfrsf19 UTSW 14 60974734 missense possibly damaging 0.70
R7936:Tnfrsf19 UTSW 14 60970933 missense probably benign 0.22
R8358:Tnfrsf19 UTSW 14 60971185 missense probably benign 0.25
R8535:Tnfrsf19 UTSW 14 60970968 missense probably benign 0.25
R8693:Tnfrsf19 UTSW 14 60971002 missense probably benign
R9028:Tnfrsf19 UTSW 14 61005201 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AAGACTCTAGAGCAGCTGTCC -3'
(R):5'- ACTTTAGTAGCCATACTGAGGC -3'

Sequencing Primer
(F):5'- TGTCCCAGCCAGATCCTG -3'
(R):5'- GCCATACTGAGGCAAATTTAAAAC -3'
Posted On 2017-02-10