Incidental Mutation 'R5870:Ak6'
ID455149
Institutional Source Beutler Lab
Gene Symbol Ak6
Ensembl Gene ENSMUSG00000078941
Gene Nameadenylate kinase 6
Synonyms2810046E22Rik, 4921516M08Rik
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R5870 (G1)
Quality Score166
Status Validated
Chromosome13
Chromosomal Location100650979-100666359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100655424 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 125 (P125Q)
Ref Sequence ENSEMBL: ENSMUSP00000139407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022135] [ENSMUST00000022136] [ENSMUST00000084721] [ENSMUST00000167256] [ENSMUST00000177848] [ENSMUST00000185767] [ENSMUST00000187792] [ENSMUST00000190165] [ENSMUST00000190594] [ENSMUST00000190729] [ENSMUST00000226050]
Predicted Effect probably benign
Transcript: ENSMUST00000022135
SMART Domains Protein: ENSMUSP00000022135
Gene: ENSMUSG00000078941

DomainStartEndE-ValueType
Pfam:AAA_17 5 113 1.1e-13 PFAM
Pfam:AAA 6 45 3.6e-6 PFAM
Pfam:AAA_18 6 126 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022136
SMART Domains Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084721
AA Change: P125Q

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081772
Gene: ENSMUSG00000078941
AA Change: P125Q

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167256
AA Change: P125Q

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132143
Gene: ENSMUSG00000052293
AA Change: P125Q

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 9 129 1.4e-52 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177848
SMART Domains Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
AAA 128 280 1.1e-4 SMART
low complexity region 342 355 N/A INTRINSIC
low complexity region 552 567 N/A INTRINSIC
low complexity region 619 635 N/A INTRINSIC
low complexity region 669 687 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185767
AA Change: P125Q

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140423
Gene: ENSMUSG00000052293
AA Change: P125Q

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 2.2e-62 PFAM
Pfam:Bromo_TP 12 77 7.6e-5 PFAM
Pfam:CENP-S 15 80 5.7e-7 PFAM
Pfam:Histone 16 78 1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185901
Predicted Effect possibly damaging
Transcript: ENSMUST00000187792
AA Change: P125Q

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140051
Gene: ENSMUSG00000052293
AA Change: P125Q

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3e-62 PFAM
Pfam:CENP-S 15 80 6.9e-7 PFAM
Pfam:Histone 16 78 1.3e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190165
AA Change: P125Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139407
Gene: ENSMUSG00000052293
AA Change: P125Q

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 3.8e-62 PFAM
Pfam:CENP-S 15 80 7.9e-7 PFAM
Pfam:Histone 16 78 1.4e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190210
Predicted Effect possibly damaging
Transcript: ENSMUST00000190594
AA Change: P125Q

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140244
Gene: ENSMUSG00000052293
AA Change: P125Q

DomainStartEndE-ValueType
Pfam:TFIID-31kDa 2 130 7.3e-65 PFAM
Pfam:Histone 12 78 2.7e-7 PFAM
Pfam:CENP-S 16 80 7.6e-10 PFAM
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190729
Predicted Effect probably benign
Transcript: ENSMUST00000226050
Meta Mutation Damage Score 0.2743 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the adenylate kinase family of enzymes. The protein has a nuclear localization and contains Walker A (P-loop) and Walker B motifs and a metal-coordinating residue. The protein may be involved in regulation of Cajal body formation. In human, AK6 and TAF9 (GeneID: 6880) are two distinct genes that share 5' exons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Ak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ak6 APN 13 100664091 missense probably benign 0.05
PIT4151001:Ak6 UTSW 13 100655095 missense probably damaging 0.98
R0189:Ak6 UTSW 13 100655142 missense probably damaging 1.00
R1716:Ak6 UTSW 13 100655669 missense probably benign
R1736:Ak6 UTSW 13 100655181 splice site probably null
R4351:Ak6 UTSW 13 100655603 nonsense probably null
R4625:Ak6 UTSW 13 100655673 missense probably benign 0.00
R5690:Ak6 UTSW 13 100655621 splice site probably null
R5711:Ak6 UTSW 13 100654214 missense probably damaging 0.97
R6018:Ak6 UTSW 13 100665951 nonsense probably null
R6386:Ak6 UTSW 13 100655803 unclassified probably benign
R7524:Ak6 UTSW 13 100663907 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGACGTACGACTGGCAATC -3'
(R):5'- CTGTTGATGTTGCAGGTATAGAAGC -3'

Sequencing Primer
(F):5'- AATCCAGTGCCGTGCTGAC -3'
(R):5'- AGGCATCTGTACTGTAAACCTCTG -3'
Posted On2017-02-10