Incidental Mutation 'R5870:Ift172'
ID 455114
Institutional Source Beutler Lab
Gene Symbol Ift172
Ensembl Gene ENSMUSG00000038564
Gene Name intraflagellar transport 172
Synonyms wim
MMRRC Submission 044078-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5870 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 31253277-31291116 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31276940 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 485 (E485K)
Ref Sequence ENSEMBL: ENSMUSP00000049335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041565]
AlphaFold Q6VH22
Predicted Effect probably benign
Transcript: ENSMUST00000041565
AA Change: E485K

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: E485K

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201274
Predicted Effect unknown
Transcript: ENSMUST00000202585
AA Change: E14K
SMART Domains Protein: ENSMUSP00000144216
Gene: ENSMUSG00000038564
AA Change: E14K

DomainStartEndE-ValueType
Blast:WD40 46 78 2e-11 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000202589
AA Change: E128K
Meta Mutation Damage Score 0.1290 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Senp3 C T 11: 69,678,222 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Ift172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ift172 APN 5 31275896 missense probably damaging 1.00
IGL01399:Ift172 APN 5 31266248 missense probably benign
IGL01405:Ift172 APN 5 31261852 nonsense probably null
IGL01562:Ift172 APN 5 31267247 missense probably damaging 0.97
IGL01758:Ift172 APN 5 31280714 missense probably benign
IGL01792:Ift172 APN 5 31276871 missense probably damaging 1.00
IGL01830:Ift172 APN 5 31285292 missense probably damaging 1.00
IGL01839:Ift172 APN 5 31266350 missense probably damaging 1.00
IGL02007:Ift172 APN 5 31286604 missense probably benign 0.17
IGL02172:Ift172 APN 5 31281337 splice site probably benign
IGL02190:Ift172 APN 5 31254458 missense possibly damaging 0.51
IGL02334:Ift172 APN 5 31283058 missense probably benign 0.00
IGL02486:Ift172 APN 5 31257583 missense probably damaging 1.00
IGL02517:Ift172 APN 5 31253648 splice site probably null
IGL02571:Ift172 APN 5 31257891 missense probably damaging 1.00
IGL02626:Ift172 APN 5 31264496 missense probably benign
IGL03183:Ift172 APN 5 31272004 missense probably benign 0.06
IGL03277:Ift172 APN 5 31267298 missense possibly damaging 0.92
IGL03349:Ift172 APN 5 31284130 missense probably benign 0.05
ostinato UTSW 5 31276940 missense probably benign 0.10
pushback UTSW 5 31286945 missense probably damaging 1.00
P0042:Ift172 UTSW 5 31261455 missense probably benign 0.35
PIT4802001:Ift172 UTSW 5 31285266 missense probably benign 0.03
R0153:Ift172 UTSW 5 31260624 missense probably benign
R0328:Ift172 UTSW 5 31263851 nonsense probably null
R0357:Ift172 UTSW 5 31257900 missense possibly damaging 0.51
R0369:Ift172 UTSW 5 31253641 missense probably damaging 1.00
R0391:Ift172 UTSW 5 31286667 missense probably damaging 1.00
R0512:Ift172 UTSW 5 31285477 missense possibly damaging 0.92
R0546:Ift172 UTSW 5 31257601 missense probably benign 0.14
R0553:Ift172 UTSW 5 31275842 splice site probably benign
R0606:Ift172 UTSW 5 31254313 missense probably damaging 0.99
R0834:Ift172 UTSW 5 31257371 missense probably benign
R0973:Ift172 UTSW 5 31265355 missense probably benign
R0973:Ift172 UTSW 5 31257918 unclassified probably benign
R1189:Ift172 UTSW 5 31285830 critical splice acceptor site probably null
R1205:Ift172 UTSW 5 31285792 missense probably benign
R1289:Ift172 UTSW 5 31280976 missense probably damaging 0.98
R1342:Ift172 UTSW 5 31261866 missense probably benign
R1395:Ift172 UTSW 5 31285238 unclassified probably benign
R1417:Ift172 UTSW 5 31256649 missense probably damaging 1.00
R2020:Ift172 UTSW 5 31267241 nonsense probably null
R2111:Ift172 UTSW 5 31286079 missense probably benign 0.04
R2175:Ift172 UTSW 5 31266685 missense probably damaging 1.00
R2509:Ift172 UTSW 5 31262968 missense probably benign
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R3705:Ift172 UTSW 5 31261437 critical splice donor site probably null
R3793:Ift172 UTSW 5 31257581 missense possibly damaging 0.61
R4385:Ift172 UTSW 5 31286967 missense probably damaging 1.00
R4477:Ift172 UTSW 5 31265437 missense probably benign 0.38
R4590:Ift172 UTSW 5 31253955 missense probably damaging 1.00
R4663:Ift172 UTSW 5 31284215 missense probably benign 0.01
R4665:Ift172 UTSW 5 31285254 missense possibly damaging 0.82
R4977:Ift172 UTSW 5 31272116 missense possibly damaging 0.79
R5109:Ift172 UTSW 5 31265986 missense probably benign 0.06
R5182:Ift172 UTSW 5 31267614 missense possibly damaging 0.51
R5343:Ift172 UTSW 5 31263812 missense probably benign 0.05
R5465:Ift172 UTSW 5 31261518 splice site probably null
R5622:Ift172 UTSW 5 31283082 missense probably damaging 1.00
R5718:Ift172 UTSW 5 31255277 missense possibly damaging 0.94
R5793:Ift172 UTSW 5 31276948 missense possibly damaging 0.96
R5919:Ift172 UTSW 5 31260662 missense possibly damaging 0.63
R5968:Ift172 UTSW 5 31261484 missense probably damaging 1.00
R6112:Ift172 UTSW 5 31256897 missense probably benign
R6339:Ift172 UTSW 5 31256583 missense probably benign 0.00
R6339:Ift172 UTSW 5 31286945 missense probably damaging 1.00
R6355:Ift172 UTSW 5 31284157 missense probably benign 0.33
R6565:Ift172 UTSW 5 31275883 missense possibly damaging 0.68
R6668:Ift172 UTSW 5 31255339 missense probably benign 0.00
R6755:Ift172 UTSW 5 31260998 nonsense probably null
R6818:Ift172 UTSW 5 31265960 missense probably benign 0.01
R6939:Ift172 UTSW 5 31257586 missense probably damaging 1.00
R6980:Ift172 UTSW 5 31257386 missense probably benign
R7047:Ift172 UTSW 5 31275894 nonsense probably null
R7156:Ift172 UTSW 5 31272075 missense probably damaging 1.00
R7180:Ift172 UTSW 5 31254262 missense probably damaging 1.00
R7288:Ift172 UTSW 5 31285286 missense probably damaging 1.00
R7351:Ift172 UTSW 5 31275896 missense probably damaging 1.00
R7706:Ift172 UTSW 5 31266379 nonsense probably null
R7890:Ift172 UTSW 5 31283081 nonsense probably null
R7980:Ift172 UTSW 5 31260644 missense probably benign
R8263:Ift172 UTSW 5 31265337 missense possibly damaging 0.48
R8559:Ift172 UTSW 5 31256577 missense probably damaging 0.98
R8717:Ift172 UTSW 5 31255641 missense probably benign 0.00
R8774:Ift172 UTSW 5 31257863 missense probably benign 0.45
R8774-TAIL:Ift172 UTSW 5 31257863 missense probably benign 0.45
R9037:Ift172 UTSW 5 31263056 missense possibly damaging 0.56
R9038:Ift172 UTSW 5 31284055 missense possibly damaging 0.53
R9133:Ift172 UTSW 5 31285523 missense probably benign 0.00
R9607:Ift172 UTSW 5 31253569 missense
X0022:Ift172 UTSW 5 31285320 missense probably damaging 0.97
Z1176:Ift172 UTSW 5 31276924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGATAGAATACAGACTGTCC -3'
(R):5'- AGTCCTCACTGATACCCCTG -3'

Sequencing Primer
(F):5'- AGAATACAGACTGTCCTTTGTTCC -3'
(R):5'- CTGATACCCCTGGACTGATGAAATG -3'
Posted On 2017-02-10