Mutagenetix > Incidental Mutation

Incidental Mutation 'R5870:Stxbp4'

455144

Institutional Source

Beutler Lab

Gene Symbol

Stxbp4

Ensembl Gene

ENSMUSG00000020546

Gene Name

syntaxin binding protein 4

Synonyms

Synip, 6030470M02Rik

MMRRC Submission

044078-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90476492-90638084 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90537956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 441 (I441N)

Ref Sequence

ENSEMBL: ENSMUSP00000116191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020858] [ENSMUST00000143203]

AlphaFold

Q9WV89

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020858
AA Change: I441N

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020858
Gene: ENSMUSG00000020546
AA Change: I441N

Domain	Start	End	E-Value	Type
PDZ	29	109	6.13e-10	SMART
low complexity region	131	154	N/A	INTRINSIC
coiled coil region	298	409	N/A	INTRINSIC
low complexity region	504	522	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119669

Predicted Effect

unknown
Transcript: ENSMUST00000123260
AA Change: I74N

SMART Domains

Protein: ENSMUSP00000122365
Gene: ENSMUSG00000020546
AA Change: I74N

Domain	Start	End	E-Value	Type
coiled coil region	3	42	N/A	INTRINSIC
SCOP:d1i5hw_	132	153	6e-7	SMART
Blast:WW	135	153	3e-7	BLAST
PDB:2YSG\|A	136	153	4e-7	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000143203
AA Change: I441N

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116191
Gene: ENSMUSG00000020546
AA Change: I441N

Domain	Start	End	E-Value	Type
PDZ	29	109	6.13e-10	SMART
low complexity region	131	154	N/A	INTRINSIC
coiled coil region	298	409	N/A	INTRINSIC
WW	501	533	1.11e-10	SMART

Meta Mutation Damage Score

0.1932

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.1%

Validation Efficiency

93% (84/90)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	A	G	16: 4,418,368	V156A	probably damaging	Het
Ak6	C	A	13: 100,655,424	P125Q	probably damaging	Het
Aqp4	A	C	18: 15,399,889	V49G	probably damaging	Het
Arfgef1	A	G	1: 10,180,938	I874T	probably damaging	Het
Arid1a	T	C	4: 133,681,076	D2040G	unknown	Het
Atp1a3	T	G	7: 24,997,578	D220A	probably benign	Het
C2cd4c	A	T	10: 79,612,209	I368N	possibly damaging	Het
Ccnt1	G	A	15: 98,543,513	Q625*	probably null	Het
Cd177	T	A	7: 24,756,332	H255L	probably benign	Het
Cdipt	G	A	7: 126,978,922	V114M	probably benign	Het
Coro1b	T	A	19: 4,149,385	H14Q	probably damaging	Het
Ctdp1	T	A	18: 80,408,686	D158V	unknown	Het
Cts7	A	T	13: 61,355,731	S140T	probably damaging	Het
Dlgap3	T	A	4: 127,195,709	L366*	probably null	Het
Dnah9	C	T	11: 66,085,210	A1338T	probably benign	Het
Dock7	T	C	4: 99,063,962	I424V	probably benign	Het
Dock8	G	T	19: 25,132,126	A891S	probably benign	Het
Elmod3	A	G	6: 72,594,738		probably null	Het
Eps15	G	A	4: 109,361,310	E107K	probably damaging	Het
Esco1	A	T	18: 10,593,744		probably null	Het
Fuz	A	G	7: 44,900,318	T407A	probably damaging	Het
Galr1	A	T	18: 82,406,072	F27I	probably benign	Het
Glt1d1	A	G	5: 127,677,280	Y182C	probably damaging	Het
Gm37240	A	T	3: 84,690,521		probably benign	Het
Gm37610	A	G	6: 41,084,914		noncoding transcript	Het
Gm6658	G	T	8: 90,908,392		probably benign	Het
Gm9376	A	G	14: 118,267,377	T74A	possibly damaging	Het
Hadha	G	A	5: 30,144,286	S109F	possibly damaging	Het
Herc3	A	T	6: 58,916,450	Q899L	probably benign	Het
Ift172	C	T	5: 31,276,940	E485K	probably benign	Het
Lrrc8e	A	G	8: 4,235,725	K650R	possibly damaging	Het
Ly6d	A	T	15: 74,763,532	V10D	possibly damaging	Het
Med27	A	G	2: 29,389,811		probably null	Het
Med29	A	T	7: 28,392,497	V56E	probably damaging	Het
Mobp	A	G	9: 120,167,853	K17E	probably damaging	Het
Mrpl37	G	A	4: 107,066,722	T25I	probably benign	Het
Myh1	A	G	11: 67,201,979	D33G	possibly damaging	Het
Nrg3	T	A	14: 39,472,629	I58F	possibly damaging	Het
Olfr589	A	G	7: 103,155,741	I2T	probably benign	Het
Olfr872	A	G	9: 20,260,578	D246G	probably benign	Het
Padi1	T	A	4: 140,826,581	D359V	probably benign	Het
Pcdh7	T	C	5: 57,720,411	V436A	possibly damaging	Het
Pgm3	C	A	9: 86,570,361	K15N	probably damaging	Het
Phip	A	T	9: 82,908,677		probably benign	Het
Pot1a	G	A	6: 25,778,951	T48I	possibly damaging	Het
Ppic	T	C	18: 53,409,261	K125R	probably benign	Het
Ppm1j	T	C	3: 104,785,495	V440A	possibly damaging	Het
Prg4	T	A	1: 150,455,549	K458*	probably null	Het
Rd3	A	T	1: 191,985,300	M244L	probably benign	Het
Rflnb	A	G	11: 76,022,038	Y175H	probably benign	Het
Rnf157	T	A	11: 116,347,074	S574C	probably benign	Het
Sardh	A	G	2: 27,220,641		probably null	Het
Senp3	C	T	11: 69,678,222		probably null	Het
Siglec1	G	A	2: 131,072,847	R1450C	probably damaging	Het
Sim2	A	G	16: 94,123,334	H446R	probably damaging	Het
Spon1	T	C	7: 114,031,786	I444T	probably damaging	Het
Srebf1	T	A	11: 60,203,584	Q568H	possibly damaging	Het
Sugt1	G	A	14: 79,609,011	V163I	probably benign	Het
Surf1	G	T	2: 26,916,259		probably benign	Het
Synj2	A	G	17: 6,037,853	E1348G	probably benign	Het
Tc2n	A	T	12: 101,652,852	V349D	probably damaging	Het
Ten1	A	G	11: 116,214,925	R112G	possibly damaging	Het
Tm9sf4	A	G	2: 153,194,281	D321G	probably damaging	Het
Ttll12	A	T	15: 83,577,036	M594K	probably damaging	Het
Ttn	T	A	2: 76,872,714		probably benign	Het
Usp28	C	T	9: 49,025,985	Q185*	probably null	Het
Vmn2r112	A	G	17: 22,619,023	I822V	probably benign	Het
Wdr60	A	G	12: 116,256,245	S26P	possibly damaging	Het
Zc3hc1	A	T	6: 30,382,683	L88*	probably null	Het
Zfr	T	A	15: 12,160,615	V758D	probably damaging	Het
Zfyve27	T	G	19: 42,171,671	L42R	probably benign	Het

Other mutations in Stxbp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Stxbp4	APN	11	90535512	missense	probably benign	0.00
IGL01312:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01313:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01314:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01316:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01377:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01380:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01385:Stxbp4	APN	11	90540248	missense	possibly damaging	0.95
IGL01408:Stxbp4	APN	11	90621649	splice site	probably benign
IGL02573:Stxbp4	APN	11	90540269	missense	probably damaging	0.99
IGL02707:Stxbp4	APN	11	90537933	missense	probably benign	0.00
IGL02809:Stxbp4	APN	11	90600184	critical splice donor site	probably null
IGL02900:Stxbp4	APN	11	90607035	missense	probably benign	0.03
IGL03177:Stxbp4	APN	11	90571753	missense	probably benign	0.01
IGL03397:Stxbp4	APN	11	90540234	missense	probably damaging	1.00
IGL02799:Stxbp4	UTSW	11	90494600	critical splice donor site	probably null
IGL03134:Stxbp4	UTSW	11	90607184	missense	probably damaging	0.98
R0005:Stxbp4	UTSW	11	90548917	missense	possibly damaging	0.78
R0487:Stxbp4	UTSW	11	90592360	missense	probably benign	0.00
R0930:Stxbp4	UTSW	11	90621700	start codon destroyed	probably null	0.99
R1633:Stxbp4	UTSW	11	90540160	splice site	probably benign
R3785:Stxbp4	UTSW	11	90535615	critical splice acceptor site	probably null
R4359:Stxbp4	UTSW	11	90494644	nonsense	probably null
R4591:Stxbp4	UTSW	11	90594780	missense	probably benign	0.33
R4756:Stxbp4	UTSW	11	90607371	missense	probably damaging	1.00
R5095:Stxbp4	UTSW	11	90548975	missense	probably benign	0.00
R6268:Stxbp4	UTSW	11	90540201	nonsense	probably null
R6460:Stxbp4	UTSW	11	90606985	missense	probably benign	0.35
R6479:Stxbp4	UTSW	11	90619187	missense	probably damaging	0.99
R7139:Stxbp4	UTSW	11	90607009	nonsense	probably null
R7349:Stxbp4	UTSW	11	90592111	splice site	probably null
R7481:Stxbp4	UTSW	11	90594813	missense	possibly damaging	0.94
R7812:Stxbp4	UTSW	11	90594828	missense	probably damaging	1.00
R8903:Stxbp4	UTSW	11	90535441	missense	unknown
R9023:Stxbp4	UTSW	11	90535423	missense	unknown
R9100:Stxbp4	UTSW	11	90535494	missense	possibly damaging	0.77
V8831:Stxbp4	UTSW	11	90480671	missense	probably benign	0.34
Z1176:Stxbp4	UTSW	11	90480671	missense	probably benign	0.34
Z1177:Stxbp4	UTSW	11	90480671	missense	probably benign	0.34
Z1177:Stxbp4	UTSW	11	90592331	critical splice donor site	probably null
Z1177:Stxbp4	UTSW	11	90600146	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGCCGTCTAAATGCTTCTAGC -3'
(R):5'- ACATGTCAATATAGTTGTCTCCCC -3'

Sequencing Primer
(F):5'- CAGTTTCTTAGGGAGATAGAACCC -3'
(R):5'- GTTGTCTCCCCCACCATAACAGG -3'

Posted On

2017-02-10