Incidental Mutation 'R5878:Shcbp1'
ID455658
Institutional Source Beutler Lab
Gene Symbol Shcbp1
Ensembl Gene ENSMUSG00000022322
Gene NameShc SH2-domain binding protein 1
SynonymsmPAL
MMRRC Submission 044084-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5878 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location4735976-4779567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4748742 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 392 (H392Q)
Ref Sequence ENSEMBL: ENSMUSP00000022945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022945]
Predicted Effect probably benign
Transcript: ENSMUST00000022945
AA Change: H392Q

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: H392Q

DomainStartEndE-ValueType
low complexity region 210 219 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
PbH1 428 451 8.61e3 SMART
PbH1 452 473 2.38e3 SMART
PbH1 474 496 9.62e2 SMART
PbH1 497 518 1.07e2 SMART
PbH1 526 548 1.74e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207665
Predicted Effect unknown
Transcript: ENSMUST00000207876
AA Change: H125Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208856
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 99% (66/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,960 S387T probably benign Het
Abca12 A T 1: 71,346,633 N275K possibly damaging Het
Abhd6 G A 14: 8,028,286 V6I probably benign Het
Afap1l2 T C 19: 56,915,675 T727A probably benign Het
Aggf1 T C 13: 95,369,557 E174G probably benign Het
Ahnak T G 19: 9,008,342 L2330R probably damaging Het
Arfgef2 A G 2: 166,870,217 T1205A probably benign Het
Ccdc3 T C 2: 5,229,016 L217P probably benign Het
Cfap54 T C 10: 92,964,561 D1595G probably benign Het
Cps1 G T 1: 67,157,878 probably null Het
Fam120b A G 17: 15,402,240 D160G probably damaging Het
Fam172a T A 13: 77,952,067 V129E probably damaging Het
Fezf1 C A 6: 23,247,581 R165L possibly damaging Het
Fkbp15 A T 4: 62,306,908 L838H probably benign Het
Frmd3 G A 4: 74,153,610 G243D probably damaging Het
Gldc A T 19: 30,143,467 probably null Het
Gm10188 T C 1: 132,229,202 probably benign Het
Gm5190 T A 12: 113,397,239 noncoding transcript Het
Gria1 T C 11: 57,317,802 probably null Het
Hdhd5 A G 6: 120,514,524 L206P probably damaging Het
Herc2 A G 7: 56,124,248 N1149S probably benign Het
Inca1 G A 11: 70,695,982 probably benign Het
Iqch G A 9: 63,547,990 S175F probably damaging Het
Itpr3 T G 17: 27,110,862 D1543E probably benign Het
Khk T A 5: 30,930,875 probably null Het
Kiz C T 2: 146,889,601 S337L probably damaging Het
Lzts3 G A 2: 130,636,539 T213I probably damaging Het
Mab21l2 T A 3: 86,546,718 D325V probably damaging Het
Mctp2 A G 7: 72,214,108 S336P probably benign Het
Me3 T A 7: 89,848,006 L405Q probably benign Het
Mgst2 A T 3: 51,661,230 probably benign Het
Myh2 A G 11: 67,192,504 E1431G probably damaging Het
Naip6 A G 13: 100,299,673 S781P probably damaging Het
Nr3c2 A G 8: 76,908,268 probably null Het
Olfr509 A T 7: 108,645,739 L279Q probably damaging Het
Olfr750 A G 14: 51,070,992 Y134H probably damaging Het
Olfr986 C T 9: 40,187,571 T152I probably benign Het
Otop1 G T 5: 38,277,822 R132L possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pcdhga4 G T 18: 37,687,686 G763W probably benign Het
Pde10a A G 17: 8,949,372 N9S possibly damaging Het
Pi4k2a T C 19: 42,100,641 I147T probably benign Het
Polh T A 17: 46,194,325 T122S probably damaging Het
Ptpn13 T C 5: 103,477,118 V96A possibly damaging Het
Ptpn6 C A 6: 124,728,785 C132F probably damaging Het
Rbm19 T A 5: 120,132,867 V585E probably damaging Het
Rp1l1 C T 14: 64,028,906 P647L probably benign Het
Rrp1b A G 17: 32,047,675 E72G probably damaging Het
Skiv2l C T 17: 34,846,117 R371Q possibly damaging Het
Slc13a5 G A 11: 72,253,391 T287I possibly damaging Het
Slc22a27 T A 19: 7,926,757 E5V probably benign Het
Slc38a2 A G 15: 96,692,584 V293A probably damaging Het
Slco6d1 T A 1: 98,463,836 probably benign Het
Sri G C 5: 8,059,353 D46H probably damaging Het
Tango6 A G 8: 106,689,168 D207G possibly damaging Het
Tigd4 T C 3: 84,594,442 M222T probably benign Het
Tmem229a T C 6: 24,955,173 D194G probably benign Het
Trank1 T C 9: 111,366,685 V1259A possibly damaging Het
Trdv5 T C 14: 54,148,798 D70G probably benign Het
Trim52 T A 14: 106,106,941 M11K probably damaging Het
Wdr62 A G 7: 30,241,347 M882T probably benign Het
Ybx3 A G 6: 131,367,763 probably null Het
Zfand2b A G 1: 75,170,510 probably benign Het
Zfp91 T A 19: 12,770,320 T480S possibly damaging Het
Other mutations in Shcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Shcbp1 APN 8 4754258 nonsense probably null
IGL01330:Shcbp1 APN 8 4736372 missense probably benign 0.00
IGL01878:Shcbp1 APN 8 4749721 missense probably damaging 0.98
IGL02415:Shcbp1 APN 8 4754239 missense possibly damaging 0.93
IGL02559:Shcbp1 APN 8 4749305 missense probably damaging 0.98
IGL03171:Shcbp1 APN 8 4739166 missense probably benign 0.05
IGL03348:Shcbp1 APN 8 4765089 missense probably benign 0.10
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0729:Shcbp1 UTSW 8 4736297 missense probably benign 0.05
R0743:Shcbp1 UTSW 8 4764906 missense probably benign
R1413:Shcbp1 UTSW 8 4741968 critical splice acceptor site probably null
R1630:Shcbp1 UTSW 8 4748763 nonsense probably null
R1645:Shcbp1 UTSW 8 4749645 missense probably benign 0.00
R3778:Shcbp1 UTSW 8 4736295 missense probably benign 0.01
R4066:Shcbp1 UTSW 8 4748716 missense probably damaging 0.98
R4232:Shcbp1 UTSW 8 4736372 missense probably benign 0.06
R4524:Shcbp1 UTSW 8 4739193 missense probably damaging 1.00
R4552:Shcbp1 UTSW 8 4749779 nonsense probably null
R4623:Shcbp1 UTSW 8 4739178 missense probably damaging 1.00
R4748:Shcbp1 UTSW 8 4744512 missense probably damaging 1.00
R5093:Shcbp1 UTSW 8 4739214 missense possibly damaging 0.68
R5152:Shcbp1 UTSW 8 4736138 missense probably damaging 1.00
R5540:Shcbp1 UTSW 8 4744529 missense probably damaging 1.00
R5758:Shcbp1 UTSW 8 4749355 unclassified probably null
R6062:Shcbp1 UTSW 8 4764905 missense probably benign 0.13
R6366:Shcbp1 UTSW 8 4749380 missense probably damaging 1.00
R6394:Shcbp1 UTSW 8 4736176 missense probably damaging 0.99
R6513:Shcbp1 UTSW 8 4744507 missense probably benign
R6696:Shcbp1 UTSW 8 4739262 missense probably damaging 1.00
R7014:Shcbp1 UTSW 8 4754234 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4741876 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4754310 missense probably damaging 1.00
R7420:Shcbp1 UTSW 8 4748737 missense probably benign 0.02
R7710:Shcbp1 UTSW 8 4764965 missense probably benign 0.14
R7720:Shcbp1 UTSW 8 4748720 missense probably damaging 1.00
R7756:Shcbp1 UTSW 8 4744545 missense probably damaging 0.97
R7769:Shcbp1 UTSW 8 4739232 missense probably damaging 1.00
X0062:Shcbp1 UTSW 8 4739249 missense probably damaging 0.99
Z1176:Shcbp1 UTSW 8 4765056 missense not run
Z1177:Shcbp1 UTSW 8 4736146 missense not run
Predicted Primers PCR Primer
(F):5'- TGACAGGCACAGGTTGTTGAG -3'
(R):5'- GTGACAAGCACACAACTGAG -3'

Sequencing Primer
(F):5'- CACAGGTTGTTGAGAAGGTAAACC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2017-02-10