Mutagenetix > Incidental Mutations

Incidental Mutation 'R2859:Itk'

476806

Institutional Source

Beutler Lab

Gene Symbol

Itk

Ensembl Gene

ENSMUSG00000020395

Gene Name

IL2 inducible T cell kinase

Synonyms

Emt, Tsk, Tcsk

MMRRC Submission

040449-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R2859 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46325150-46389515 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to G at 46344835 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104860 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]

PDB Structure

INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<

Predicted Effect

probably benign
Transcript: ENSMUST00000020664

SMART Domains

Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART
SH2	237	328	9.44e-29	SMART
TyrKc	362	611	3.28e-133	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000101306
AA Change: T261P

SMART Domains

Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395
AA Change: T261P

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109237

SMART Domains

Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395

Domain	Start	End	E-Value	Type
PH	5	119	3.94e-12	SMART
BTK	119	155	1.1e-21	SMART
SH3	180	236	5.87e-14	SMART
SH2	243	334	9.44e-29	SMART
TyrKc	368	617	3.28e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148132

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	C	17: 24,281,314	Y1301C	possibly damaging	Het
Amfr	A	T	8: 94,005,214	N11K	probably damaging	Het
C87977	A	G	4: 144,209,622	S23P	probably benign	Het
Cadm3	A	G	1: 173,346,545	S34P	possibly damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdh23	C	T	10: 60,382,653		probably null	Het
Ceacam1	T	A	7: 25,474,017	I249F	probably damaging	Het
Cuzd1	C	T	7: 131,316,134	V246M	probably damaging	Het
Ehd2	A	T	7: 15,964,129	V61E	probably damaging	Het
Fam71b	T	C	11: 46,405,212	I137T	probably damaging	Het
Fibin	C	T	2: 110,362,197	R200H	probably damaging	Het
Fmo9	A	C	1: 166,673,667	F237C	probably damaging	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Iqgap3	C	A	3: 88,107,596	S873*	probably null	Het
Ism2	T	C	12: 87,299,663	M15V	unknown	Het
Mastl	C	A	2: 23,139,967	C249F	probably damaging	Het
Mink1	T	C	11: 70,612,508	V1143A	probably damaging	Het
Mrgprb4	T	A	7: 48,198,336	R281S	possibly damaging	Het
Mthfd1	T	C	12: 76,288,925	Y258H	probably damaging	Het
Ntmt1	A	G	2: 30,822,365	H140R	probably damaging	Het
Olfr139	C	T	11: 74,044,827	G149D	possibly damaging	Het
Olfr311	T	A	11: 58,841,882	V256E	probably benign	Het
Olfr340	T	C	2: 36,453,130	S182P	probably benign	Het
Olfr401	T	C	11: 74,121,982	I231T	probably damaging	Het
Parm1	A	G	5: 91,594,306	T178A	possibly damaging	Het
Patl1	T	C	19: 11,923,831	F282L	probably damaging	Het
Phospho2	T	C	2: 69,795,851	V117A	possibly damaging	Het
Ppp4r3a	T	C	12: 101,042,647		probably null	Het
Rbm17	A	G	2: 11,590,704	F230S	possibly damaging	Het
Robo3	C	A	9: 37,428,104	G196*	probably null	Het
Samhd1	A	G	2: 157,106,229		probably null	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Thbs4	A	G	13: 92,790,708	F91S	probably benign	Het
Trim34b	A	T	7: 104,336,232	N358I	probably benign	Het
Ulk1	A	G	5: 110,794,629	L255P	probably damaging	Het
Vmn2r104	T	A	17: 20,048,193	I5F	possibly damaging	Het
Vrk2	C	A	11: 26,483,324	S286I	possibly damaging	Het
Zswim3	T	C	2: 164,820,389	L263P	probably damaging	Het

Other mutations in Itk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Itk	APN	11	46367896	missense	probably damaging	1.00
IGL01349:Itk	APN	11	46341200	missense	possibly damaging	0.84
IGL03290:Itk	APN	11	46334937	missense	probably damaging	1.00
IGL03385:Itk	APN	11	46331861	nonsense	probably null
goodnow	UTSW	11	46338099	splice site	probably null
itxaro	UTSW	11	46338217	missense	probably damaging	1.00
R0095:Itk	UTSW	11	46342452	missense	probably damaging	0.99
R0265:Itk	UTSW	11	46389458	start gained	probably benign
R0281:Itk	UTSW	11	46353916	missense	probably damaging	1.00
R0463:Itk	UTSW	11	46331989	missense	probably damaging	1.00
R0518:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R0521:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R1121:Itk	UTSW	11	46331894	missense	possibly damaging	0.93
R1550:Itk	UTSW	11	46389326	missense	probably damaging	1.00
R1762:Itk	UTSW	11	46336482	missense	probably damaging	0.98
R2418:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2419:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R3107:Itk	UTSW	11	46327464	missense	probably benign	0.15
R3546:Itk	UTSW	11	46355848	missense	probably benign	0.00
R4601:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4610:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4792:Itk	UTSW	11	46344831	intron	probably benign
R4885:Itk	UTSW	11	46336344	splice site	probably null
R4934:Itk	UTSW	11	46389325	missense	probably damaging	1.00
R5286:Itk	UTSW	11	46338099	splice site	probably null
R5328:Itk	UTSW	11	46331876	missense	probably benign	0.04
R5399:Itk	UTSW	11	46338111	missense	probably benign	0.44
R5958:Itk	UTSW	11	46344855	intron	probably benign
R6235:Itk	UTSW	11	46336428	missense	probably benign	0.16
R6828:Itk	UTSW	11	46341218	missense	probably damaging	1.00
R6849:Itk	UTSW	11	46331935	missense	probably damaging	1.00
R7356:Itk	UTSW	11	46367832	missense	possibly damaging	0.72
R7753:Itk	UTSW	11	46331895	missense	probably damaging	1.00
U24488:Itk	UTSW	11	46338144	missense	probably damaging	1.00
X0062:Itk	UTSW	11	46366044	missense	probably benign	0.15
Z1088:Itk	UTSW	11	46353862	splice site	probably null

Predicted Primers

Posted On

2017-05-15