Incidental Mutation 'R2859:Itk'
ID476806
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene NameIL2 inducible T cell kinase
SynonymsEmt, Tsk, Tcsk
MMRRC Submission 040449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2859 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46325150-46389515 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 46344835 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]
PDB Structure INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000020664
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect unknown
Transcript: ENSMUST00000101306
AA Change: T261P
SMART Domains Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395
AA Change: T261P

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109237
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148132
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,314 Y1301C possibly damaging Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cadm3 A G 1: 173,346,545 S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Mastl C A 2: 23,139,967 C249F probably damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr340 T C 2: 36,453,130 S182P probably benign Het
Olfr401 T C 11: 74,121,982 I231T probably damaging Het
Parm1 A G 5: 91,594,306 T178A possibly damaging Het
Patl1 T C 19: 11,923,831 F282L probably damaging Het
Phospho2 T C 2: 69,795,851 V117A possibly damaging Het
Ppp4r3a T C 12: 101,042,647 probably null Het
Rbm17 A G 2: 11,590,704 F230S possibly damaging Het
Robo3 C A 9: 37,428,104 G196* probably null Het
Samhd1 A G 2: 157,106,229 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Thbs4 A G 13: 92,790,708 F91S probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Ulk1 A G 5: 110,794,629 L255P probably damaging Het
Vmn2r104 T A 17: 20,048,193 I5F possibly damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Zswim3 T C 2: 164,820,389 L263P probably damaging Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
Calame UTSW 11 46342395 splice site probably null
carbone UTSW 11 46331949 nonsense probably null
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
BB009:Itk UTSW 11 46340692 missense probably benign
BB019:Itk UTSW 11 46340692 missense probably benign
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
R7932:Itk UTSW 11 46340692 missense probably benign
R7988:Itk UTSW 11 46355834 missense probably damaging 0.99
R8188:Itk UTSW 11 46331949 nonsense probably null
R8337:Itk UTSW 11 46342395 splice site probably null
R8738:Itk UTSW 11 46340712 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers
Posted On2017-05-15