Mutagenetix > Incidental Mutation

Incidental Mutation 'R2859:Itk'

476806

Institutional Source

Beutler Lab

Gene Symbol

Itk

Ensembl Gene

ENSMUSG00000020395

Gene Name

IL2 inducible T cell kinase

Synonyms

Emt, Tsk, Tcsk

MMRRC Submission

040449-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.115) question?

Stock #

R2859 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46325150-46389515 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to G at 46344835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104860 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]

AlphaFold

Q03526

PDB Structure

INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<

Predicted Effect

probably benign
Transcript: ENSMUST00000020664

SMART Domains

Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART
SH2	237	328	9.44e-29	SMART
TyrKc	362	611	3.28e-133	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000101306
AA Change: T261P

SMART Domains

Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395
AA Change: T261P

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109237

SMART Domains

Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395

Domain	Start	End	E-Value	Type
PH	5	119	3.94e-12	SMART
BTK	119	155	1.1e-21	SMART
SH3	180	236	5.87e-14	SMART
SH2	243	334	9.44e-29	SMART
TyrKc	368	617	3.28e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148132

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	C	17: 24,281,314	Y1301C	possibly damaging	Het
Amfr	A	T	8: 94,005,214	N11K	probably damaging	Het
C87977	A	G	4: 144,209,622	S23P	probably benign	Het
Cadm3	A	G	1: 173,346,545	S34P	possibly damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdh23	C	T	10: 60,382,653		probably null	Het
Ceacam1	T	A	7: 25,474,017	I249F	probably damaging	Het
Cuzd1	C	T	7: 131,316,134	V246M	probably damaging	Het
Ehd2	A	T	7: 15,964,129	V61E	probably damaging	Het
Fam71b	T	C	11: 46,405,212	I137T	probably damaging	Het
Fibin	C	T	2: 110,362,197	R200H	probably damaging	Het
Fmo9	A	C	1: 166,673,667	F237C	probably damaging	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Iqgap3	C	A	3: 88,107,596	S873*	probably null	Het
Ism2	T	C	12: 87,299,663	M15V	unknown	Het
Mastl	C	A	2: 23,139,967	C249F	probably damaging	Het
Mink1	T	C	11: 70,612,508	V1143A	probably damaging	Het
Mrgprb4	T	A	7: 48,198,336	R281S	possibly damaging	Het
Mthfd1	T	C	12: 76,288,925	Y258H	probably damaging	Het
Ntmt1	A	G	2: 30,822,365	H140R	probably damaging	Het
Olfr139	C	T	11: 74,044,827	G149D	possibly damaging	Het
Olfr311	T	A	11: 58,841,882	V256E	probably benign	Het
Olfr340	T	C	2: 36,453,130	S182P	probably benign	Het
Olfr401	T	C	11: 74,121,982	I231T	probably damaging	Het
Parm1	A	G	5: 91,594,306	T178A	possibly damaging	Het
Patl1	T	C	19: 11,923,831	F282L	probably damaging	Het
Phospho2	T	C	2: 69,795,851	V117A	possibly damaging	Het
Ppp4r3a	T	C	12: 101,042,647		probably null	Het
Rbm17	A	G	2: 11,590,704	F230S	possibly damaging	Het
Robo3	C	A	9: 37,428,104	G196*	probably null	Het
Samhd1	A	G	2: 157,106,229		probably null	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Thbs4	A	G	13: 92,790,708	F91S	probably benign	Het
Trim34b	A	T	7: 104,336,232	N358I	probably benign	Het
Ulk1	A	G	5: 110,794,629	L255P	probably damaging	Het
Vmn2r104	T	A	17: 20,048,193	I5F	possibly damaging	Het
Vrk2	C	A	11: 26,483,324	S286I	possibly damaging	Het
Zswim3	T	C	2: 164,820,389	L263P	probably damaging	Het

Other mutations in Itk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Itk	APN	11	46367896	missense	probably damaging	1.00
IGL01349:Itk	APN	11	46341200	missense	possibly damaging	0.84
IGL03290:Itk	APN	11	46334937	missense	probably damaging	1.00
IGL03385:Itk	APN	11	46331861	nonsense	probably null
Calame	UTSW	11	46342395	splice site	probably null
carbone	UTSW	11	46331949	nonsense	probably null
demon	UTSW	11	46340712	missense	probably damaging	1.00
goodnow	UTSW	11	46338099	splice site	probably null
itxaro	UTSW	11	46338217	missense	probably damaging	1.00
Segun	UTSW	11	46344883	intron	probably benign
BB009:Itk	UTSW	11	46340692	missense	probably benign
BB019:Itk	UTSW	11	46340692	missense	probably benign
R0095:Itk	UTSW	11	46342452	missense	probably damaging	0.99
R0265:Itk	UTSW	11	46389458	start gained	probably benign
R0281:Itk	UTSW	11	46353916	missense	probably damaging	1.00
R0463:Itk	UTSW	11	46331989	missense	probably damaging	1.00
R0518:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R0521:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R1121:Itk	UTSW	11	46331894	missense	possibly damaging	0.93
R1550:Itk	UTSW	11	46389326	missense	probably damaging	1.00
R1762:Itk	UTSW	11	46336482	missense	probably damaging	0.98
R2418:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2419:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R3107:Itk	UTSW	11	46327464	missense	probably benign	0.15
R3546:Itk	UTSW	11	46355848	missense	probably benign	0.00
R4601:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4610:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4792:Itk	UTSW	11	46344831	intron	probably benign
R4885:Itk	UTSW	11	46336344	splice site	probably null
R4934:Itk	UTSW	11	46389325	missense	probably damaging	1.00
R5286:Itk	UTSW	11	46338099	splice site	probably null
R5328:Itk	UTSW	11	46331876	missense	probably benign	0.04
R5399:Itk	UTSW	11	46338111	missense	probably benign	0.44
R5958:Itk	UTSW	11	46344855	intron	probably benign
R6235:Itk	UTSW	11	46336428	missense	probably benign	0.16
R6828:Itk	UTSW	11	46341218	missense	probably damaging	1.00
R6849:Itk	UTSW	11	46331935	missense	probably damaging	1.00
R7356:Itk	UTSW	11	46367832	missense	possibly damaging	0.72
R7753:Itk	UTSW	11	46331895	missense	probably damaging	1.00
R7932:Itk	UTSW	11	46340692	missense	probably benign
R7988:Itk	UTSW	11	46355834	missense	probably damaging	0.99
R8188:Itk	UTSW	11	46331949	nonsense	probably null
R8337:Itk	UTSW	11	46342395	splice site	probably null
R8738:Itk	UTSW	11	46340712	missense	probably damaging	1.00
R8993:Itk	UTSW	11	46334908	missense	probably damaging	1.00
R9028:Itk	UTSW	11	46344883	intron	probably benign
R9650:Itk	UTSW	11	46331951	missense	probably damaging	1.00
U24488:Itk	UTSW	11	46338144	missense	probably damaging	1.00
X0062:Itk	UTSW	11	46366044	missense	probably benign	0.15
Z1088:Itk	UTSW	11	46353862	splice site	probably null

Predicted Primers

Posted On

2017-05-15