Incidental Mutation 'R6017:Stab1'
ID 478664
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Name stabilin 1
Synonyms MS-1
MMRRC Submission 044191-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6017 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 30860970-30890598 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30863501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 2087 (R2087H)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000090212] [ENSMUST00000159249] [ENSMUST00000160024] [ENSMUST00000227794] [ENSMUST00000227096]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036618
AA Change: R2087H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: R2087H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090212
SMART Domains Protein: ENSMUSP00000087680
Gene: ENSMUSG00000071547

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 367 1.5e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159208
Predicted Effect probably benign
Transcript: ENSMUST00000159249
SMART Domains Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
EGF 110 147 1.26e-2 SMART
EGF 157 191 1.61e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159480
Predicted Effect probably benign
Transcript: ENSMUST00000160024
SMART Domains Protein: ENSMUSP00000125239
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
Blast:FAS1 1 32 5e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227690
Predicted Effect probably benign
Transcript: ENSMUST00000227794
Predicted Effect probably benign
Transcript: ENSMUST00000227096
Predicted Effect probably benign
Transcript: ENSMUST00000226975
Meta Mutation Damage Score 0.2177 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,325,780 (GRCm39) I56M probably damaging Het
Adgrv1 A T 13: 81,545,542 (GRCm39) L5581* probably null Het
Arpc2 C A 1: 74,301,645 (GRCm39) H193N probably benign Het
B3galt5 A G 16: 96,116,384 (GRCm39) T6A probably benign Het
Bod1l A T 5: 41,976,103 (GRCm39) V1737E probably benign Het
Cacfd1 T G 2: 26,903,440 (GRCm39) probably benign Het
Cdc42ep4 A T 11: 113,620,192 (GRCm39) D66E probably benign Het
Cldn1 G T 16: 26,181,969 (GRCm39) T80N probably damaging Het
Cmtm1 C A 8: 105,037,583 (GRCm39) probably benign Het
Cntnap5c A T 17: 58,411,693 (GRCm39) I526F probably benign Het
Copb1 T C 7: 113,836,032 (GRCm39) K450E probably benign Het
Crebrf A C 17: 26,976,823 (GRCm39) I416L probably benign Het
Csmd3 C A 15: 48,177,408 (GRCm39) V377F possibly damaging Het
Cyp1a2 T C 9: 57,588,313 (GRCm39) K304E probably damaging Het
Cyp2d26 A G 15: 82,674,774 (GRCm39) S403P possibly damaging Het
Cyp4a12a T A 4: 115,183,476 (GRCm39) C198* probably null Het
Ddx11 A G 17: 66,437,012 (GRCm39) D102G Het
Dpys T A 15: 39,710,114 (GRCm39) Q105L probably null Het
Dsn1 C A 2: 156,838,162 (GRCm39) R334L probably damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Epha8 G T 4: 136,659,054 (GRCm39) H867N probably damaging Het
Ephb3 T C 16: 21,040,781 (GRCm39) L643P probably damaging Het
Fbxo44 G T 4: 148,243,010 (GRCm39) H83Q probably benign Het
Gm13102 T C 4: 143,835,807 (GRCm39) Y477H possibly damaging Het
Gm7347 T C 5: 26,262,276 (GRCm39) T82A probably benign Het
Gss C A 2: 155,429,385 (GRCm39) A36S probably benign Het
Hepacam A G 9: 37,292,056 (GRCm39) D128G probably benign Het
Hepacam2 C A 6: 3,483,332 (GRCm39) V226F probably damaging Het
Hgfac T C 5: 35,201,739 (GRCm39) Y291H probably damaging Het
Ip6k2 G A 9: 108,674,466 (GRCm39) R88H probably benign Het
Irx5 T A 8: 93,084,878 (GRCm39) Y23N probably damaging Het
Kcnf1 T C 12: 17,225,082 (GRCm39) M380V probably damaging Het
Kcnj1 A T 9: 32,305,400 (GRCm39) probably benign Het
Kcnk12 T C 17: 88,054,164 (GRCm39) E166G probably damaging Het
Kctd16 T C 18: 40,391,996 (GRCm39) C195R probably damaging Het
Kif28 T A 1: 179,527,018 (GRCm39) I718F probably benign Het
Lce1e T A 3: 92,615,240 (GRCm39) K36* probably null Het
Map4 T C 9: 109,863,687 (GRCm39) L304P probably benign Het
Mettl17 C T 14: 52,129,074 (GRCm39) probably benign Het
Mpp4 T C 1: 59,160,518 (GRCm39) D595G probably damaging Het
Myo18a A G 11: 77,732,349 (GRCm39) K1282E probably damaging Het
Nf2 A T 11: 4,766,137 (GRCm39) V131D possibly damaging Het
Or7g35 T C 9: 19,496,730 (GRCm39) V299A probably benign Het
Or8b3 A T 9: 38,314,916 (GRCm39) M249L probably benign Het
Oxsr1 A G 9: 119,093,843 (GRCm39) L270S probably benign Het
Plekhg2 G A 7: 28,062,309 (GRCm39) T536I probably damaging Het
Ppp1r9a T A 6: 4,906,363 (GRCm39) V306D probably benign Het
Ptk6 C T 2: 180,837,605 (GRCm39) C438Y probably benign Het
Scfd1 T C 12: 51,492,461 (GRCm39) V590A probably damaging Het
Serpina1b A G 12: 103,695,531 (GRCm39) S337P probably damaging Het
Skor2 T A 18: 76,946,622 (GRCm39) C115S unknown Het
Slc2a7 T C 4: 150,249,629 (GRCm39) S407P probably damaging Het
Slc8a1 A G 17: 81,955,683 (GRCm39) S452P probably damaging Het
Spata31d1c A G 13: 65,182,893 (GRCm39) D145G possibly damaging Het
Spata6 C A 4: 111,632,024 (GRCm39) T145K probably damaging Het
Stk24 C T 14: 121,539,657 (GRCm39) V180M probably benign Het
Trrap A G 5: 144,781,051 (GRCm39) T3271A probably damaging Het
Tyro3 T A 2: 119,647,147 (GRCm39) W755R probably damaging Het
Ush2a T C 1: 188,689,711 (GRCm39) probably null Het
Uts2b T C 16: 27,179,793 (GRCm39) probably null Het
Vmn2r105 T A 17: 20,428,889 (GRCm39) H729L probably damaging Het
Vps35l T A 7: 118,409,144 (GRCm39) V635D probably damaging Het
Wdfy3 T C 5: 101,999,225 (GRCm39) I3068V probably benign Het
Zfp457 G A 13: 67,441,763 (GRCm39) H175Y probably damaging Het
Zfp758 A G 17: 22,592,712 (GRCm39) D40G probably damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 30,883,314 (GRCm39) missense probably benign 0.01
IGL00323:Stab1 APN 14 30,861,263 (GRCm39) missense probably benign 0.04
IGL00515:Stab1 APN 14 30,881,686 (GRCm39) missense probably benign 0.20
IGL00844:Stab1 APN 14 30,869,023 (GRCm39) missense probably damaging 1.00
IGL01374:Stab1 APN 14 30,869,032 (GRCm39) missense probably damaging 1.00
IGL01384:Stab1 APN 14 30,872,365 (GRCm39) missense probably benign
IGL01431:Stab1 APN 14 30,870,952 (GRCm39) missense probably benign 0.06
IGL01787:Stab1 APN 14 30,861,765 (GRCm39) missense probably damaging 1.00
IGL02128:Stab1 APN 14 30,872,398 (GRCm39) missense probably damaging 1.00
IGL02138:Stab1 APN 14 30,865,470 (GRCm39) critical splice donor site probably null
IGL02256:Stab1 APN 14 30,863,549 (GRCm39) missense probably damaging 1.00
IGL02340:Stab1 APN 14 30,862,367 (GRCm39) missense probably damaging 0.96
IGL02507:Stab1 APN 14 30,861,167 (GRCm39) unclassified probably benign
IGL02695:Stab1 APN 14 30,881,228 (GRCm39) missense probably damaging 1.00
IGL02755:Stab1 APN 14 30,861,595 (GRCm39) missense probably benign 0.01
IGL02870:Stab1 APN 14 30,861,354 (GRCm39) missense probably benign 0.00
IGL02884:Stab1 APN 14 30,872,100 (GRCm39) splice site probably null
IGL03035:Stab1 APN 14 30,869,726 (GRCm39) missense probably benign 0.00
IGL03267:Stab1 APN 14 30,864,686 (GRCm39) missense probably damaging 1.00
IGL03286:Stab1 APN 14 30,881,283 (GRCm39) splice site probably benign
IGL03366:Stab1 APN 14 30,872,220 (GRCm39) missense possibly damaging 0.58
IGL03412:Stab1 APN 14 30,876,364 (GRCm39) missense probably benign 0.42
R0906_Stab1_335 UTSW 14 30,867,206 (GRCm39) missense probably benign 0.19
R5086_Stab1_467 UTSW 14 30,881,261 (GRCm39) missense probably damaging 1.00
IGL02835:Stab1 UTSW 14 30,867,981 (GRCm39) critical splice donor site probably null
K7371:Stab1 UTSW 14 30,872,206 (GRCm39) missense probably damaging 1.00
R0053:Stab1 UTSW 14 30,862,644 (GRCm39) missense possibly damaging 0.57
R0053:Stab1 UTSW 14 30,862,644 (GRCm39) missense possibly damaging 0.57
R0066:Stab1 UTSW 14 30,879,027 (GRCm39) splice site probably benign
R0066:Stab1 UTSW 14 30,879,027 (GRCm39) splice site probably benign
R0363:Stab1 UTSW 14 30,880,965 (GRCm39) splice site probably benign
R0387:Stab1 UTSW 14 30,870,058 (GRCm39) missense probably benign 0.00
R0391:Stab1 UTSW 14 30,865,375 (GRCm39) missense probably benign 0.21
R0513:Stab1 UTSW 14 30,870,902 (GRCm39) missense probably benign 0.08
R0546:Stab1 UTSW 14 30,861,507 (GRCm39) missense possibly damaging 0.92
R0825:Stab1 UTSW 14 30,874,557 (GRCm39) missense probably benign 0.16
R0906:Stab1 UTSW 14 30,867,206 (GRCm39) missense probably benign 0.19
R0963:Stab1 UTSW 14 30,869,231 (GRCm39) missense probably damaging 0.97
R1219:Stab1 UTSW 14 30,862,578 (GRCm39) splice site probably null
R1234:Stab1 UTSW 14 30,872,193 (GRCm39) missense probably damaging 1.00
R1260:Stab1 UTSW 14 30,873,846 (GRCm39) missense probably damaging 1.00
R1400:Stab1 UTSW 14 30,861,787 (GRCm39) missense possibly damaging 0.92
R1405:Stab1 UTSW 14 30,870,958 (GRCm39) missense probably benign 0.19
R1405:Stab1 UTSW 14 30,870,958 (GRCm39) missense probably benign 0.19
R1440:Stab1 UTSW 14 30,873,647 (GRCm39) nonsense probably null
R1472:Stab1 UTSW 14 30,863,543 (GRCm39) missense probably benign 0.01
R1474:Stab1 UTSW 14 30,871,818 (GRCm39) missense probably benign 0.45
R1475:Stab1 UTSW 14 30,885,785 (GRCm39) missense probably benign
R1509:Stab1 UTSW 14 30,873,541 (GRCm39) splice site probably benign
R1551:Stab1 UTSW 14 30,882,456 (GRCm39) missense probably benign 0.00
R1572:Stab1 UTSW 14 30,872,780 (GRCm39) missense probably damaging 1.00
R1633:Stab1 UTSW 14 30,872,337 (GRCm39) splice site probably null
R1719:Stab1 UTSW 14 30,867,985 (GRCm39) nonsense probably null
R1733:Stab1 UTSW 14 30,867,260 (GRCm39) missense probably damaging 1.00
R1763:Stab1 UTSW 14 30,890,373 (GRCm39) missense probably benign 0.04
R1808:Stab1 UTSW 14 30,863,101 (GRCm39) missense possibly damaging 0.80
R1816:Stab1 UTSW 14 30,879,422 (GRCm39) missense probably benign 0.03
R1853:Stab1 UTSW 14 30,862,420 (GRCm39) missense probably damaging 1.00
R1891:Stab1 UTSW 14 30,863,287 (GRCm39) missense probably benign 0.07
R1984:Stab1 UTSW 14 30,872,605 (GRCm39) missense probably benign 0.20
R1998:Stab1 UTSW 14 30,884,110 (GRCm39) nonsense probably null
R2165:Stab1 UTSW 14 30,890,392 (GRCm39) missense probably benign 0.20
R2191:Stab1 UTSW 14 30,881,227 (GRCm39) missense probably damaging 1.00
R2191:Stab1 UTSW 14 30,864,757 (GRCm39) missense probably benign 0.03
R2233:Stab1 UTSW 14 30,883,837 (GRCm39) missense probably benign 0.08
R2303:Stab1 UTSW 14 30,868,027 (GRCm39) missense probably damaging 1.00
R2496:Stab1 UTSW 14 30,883,420 (GRCm39) missense probably damaging 1.00
R2504:Stab1 UTSW 14 30,884,997 (GRCm39) critical splice donor site probably null
R2519:Stab1 UTSW 14 30,876,829 (GRCm39) missense probably damaging 1.00
R2926:Stab1 UTSW 14 30,883,756 (GRCm39) missense probably damaging 1.00
R4025:Stab1 UTSW 14 30,876,909 (GRCm39) missense possibly damaging 0.46
R4113:Stab1 UTSW 14 30,890,436 (GRCm39) missense probably damaging 0.98
R4258:Stab1 UTSW 14 30,876,629 (GRCm39) missense possibly damaging 0.92
R4588:Stab1 UTSW 14 30,879,402 (GRCm39) missense probably benign 0.01
R4644:Stab1 UTSW 14 30,862,444 (GRCm39) unclassified probably benign
R4660:Stab1 UTSW 14 30,876,872 (GRCm39) missense possibly damaging 0.91
R4801:Stab1 UTSW 14 30,863,328 (GRCm39) nonsense probably null
R4802:Stab1 UTSW 14 30,863,328 (GRCm39) nonsense probably null
R4870:Stab1 UTSW 14 30,864,000 (GRCm39) missense probably benign 0.13
R4872:Stab1 UTSW 14 30,862,350 (GRCm39) missense probably damaging 1.00
R4881:Stab1 UTSW 14 30,865,629 (GRCm39) missense probably benign 0.32
R4941:Stab1 UTSW 14 30,873,528 (GRCm39) missense probably benign 0.00
R5061:Stab1 UTSW 14 30,885,056 (GRCm39) missense probably damaging 1.00
R5086:Stab1 UTSW 14 30,881,261 (GRCm39) missense probably damaging 1.00
R5086:Stab1 UTSW 14 30,865,581 (GRCm39) missense probably damaging 1.00
R5087:Stab1 UTSW 14 30,881,261 (GRCm39) missense probably damaging 1.00
R5092:Stab1 UTSW 14 30,867,812 (GRCm39) missense probably benign 0.01
R5102:Stab1 UTSW 14 30,869,974 (GRCm39) critical splice donor site probably null
R5107:Stab1 UTSW 14 30,885,752 (GRCm39) splice site probably null
R5195:Stab1 UTSW 14 30,862,478 (GRCm39) unclassified probably benign
R5217:Stab1 UTSW 14 30,881,476 (GRCm39) missense probably benign 0.25
R5285:Stab1 UTSW 14 30,865,433 (GRCm39) unclassified probably benign
R5327:Stab1 UTSW 14 30,883,793 (GRCm39) nonsense probably null
R5647:Stab1 UTSW 14 30,879,397 (GRCm39) nonsense probably null
R5696:Stab1 UTSW 14 30,882,178 (GRCm39) missense probably benign
R5996:Stab1 UTSW 14 30,861,508 (GRCm39) missense probably benign 0.39
R6016:Stab1 UTSW 14 30,880,950 (GRCm39) missense probably damaging 1.00
R6174:Stab1 UTSW 14 30,884,476 (GRCm39) nonsense probably null
R6366:Stab1 UTSW 14 30,863,395 (GRCm39) missense probably benign 0.10
R6754:Stab1 UTSW 14 30,863,038 (GRCm39) missense probably benign
R6788:Stab1 UTSW 14 30,861,117 (GRCm39) missense probably damaging 1.00
R6898:Stab1 UTSW 14 30,880,920 (GRCm39) missense probably benign 0.00
R7124:Stab1 UTSW 14 30,882,824 (GRCm39) missense possibly damaging 0.94
R7145:Stab1 UTSW 14 30,867,030 (GRCm39) critical splice donor site probably null
R7153:Stab1 UTSW 14 30,882,541 (GRCm39) missense probably benign 0.16
R7213:Stab1 UTSW 14 30,865,630 (GRCm39) missense probably benign
R7215:Stab1 UTSW 14 30,882,754 (GRCm39) missense possibly damaging 0.93
R7319:Stab1 UTSW 14 30,862,783 (GRCm39) missense probably damaging 1.00
R7389:Stab1 UTSW 14 30,869,196 (GRCm39) missense probably benign 0.00
R7400:Stab1 UTSW 14 30,879,341 (GRCm39) missense probably null 1.00
R7427:Stab1 UTSW 14 30,881,216 (GRCm39) missense probably benign 0.00
R7428:Stab1 UTSW 14 30,881,216 (GRCm39) missense probably benign 0.00
R7484:Stab1 UTSW 14 30,882,274 (GRCm39) missense probably benign 0.00
R7568:Stab1 UTSW 14 30,874,552 (GRCm39) missense probably damaging 1.00
R7574:Stab1 UTSW 14 30,876,622 (GRCm39) missense probably benign
R7619:Stab1 UTSW 14 30,867,194 (GRCm39) missense probably benign
R7623:Stab1 UTSW 14 30,862,578 (GRCm39) missense probably benign 0.03
R7721:Stab1 UTSW 14 30,863,413 (GRCm39) missense possibly damaging 0.48
R7869:Stab1 UTSW 14 30,876,429 (GRCm39) missense probably benign 0.01
R7936:Stab1 UTSW 14 30,879,372 (GRCm39) missense possibly damaging 0.88
R7956:Stab1 UTSW 14 30,881,981 (GRCm39) missense probably benign 0.02
R7973:Stab1 UTSW 14 30,881,590 (GRCm39) critical splice donor site probably null
R8059:Stab1 UTSW 14 30,882,198 (GRCm39) missense probably benign 0.02
R8116:Stab1 UTSW 14 30,880,910 (GRCm39) missense possibly damaging 0.80
R8304:Stab1 UTSW 14 30,870,911 (GRCm39) missense probably benign 0.14
R8368:Stab1 UTSW 14 30,870,368 (GRCm39) missense possibly damaging 0.91
R8495:Stab1 UTSW 14 30,877,790 (GRCm39) missense probably damaging 1.00
R8513:Stab1 UTSW 14 30,871,747 (GRCm39) critical splice donor site probably null
R8544:Stab1 UTSW 14 30,885,008 (GRCm39) nonsense probably null
R8671:Stab1 UTSW 14 30,879,365 (GRCm39) missense probably damaging 1.00
R8885:Stab1 UTSW 14 30,883,771 (GRCm39) missense possibly damaging 0.79
R8974:Stab1 UTSW 14 30,882,779 (GRCm39) missense probably benign
R9022:Stab1 UTSW 14 30,882,226 (GRCm39) missense probably benign 0.01
R9059:Stab1 UTSW 14 30,876,805 (GRCm39) missense probably benign 0.01
R9226:Stab1 UTSW 14 30,867,812 (GRCm39) missense probably benign 0.00
R9272:Stab1 UTSW 14 30,867,298 (GRCm39) missense probably benign 0.05
R9388:Stab1 UTSW 14 30,876,312 (GRCm39) missense probably damaging 1.00
R9401:Stab1 UTSW 14 30,883,069 (GRCm39) missense probably benign
R9433:Stab1 UTSW 14 30,865,531 (GRCm39) missense probably benign 0.00
R9450:Stab1 UTSW 14 30,884,896 (GRCm39) missense possibly damaging 0.62
R9505:Stab1 UTSW 14 30,877,722 (GRCm39) missense probably damaging 1.00
R9570:Stab1 UTSW 14 30,864,638 (GRCm39) missense probably benign 0.01
R9624:Stab1 UTSW 14 30,863,345 (GRCm39) missense
R9694:Stab1 UTSW 14 30,876,901 (GRCm39) missense probably benign 0.06
R9723:Stab1 UTSW 14 30,885,848 (GRCm39) missense probably benign 0.10
X0026:Stab1 UTSW 14 30,884,148 (GRCm39) missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 30,872,617 (GRCm39) missense probably benign 0.00
Z1176:Stab1 UTSW 14 30,863,995 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACCCTCATAGTCAGGCAG -3'
(R):5'- GAGTAGCCCTTGAACCTGTG -3'

Sequencing Primer
(F):5'- CTCATAGTCAGGCAGGCAGGTG -3'
(R):5'- ATGTGTGTACATGCCCCAG -3'
Posted On 2017-06-26