Mutagenetix > Incidental Mutations

Incidental Mutation 'R6128:Pik3cb'

487520

Institutional Source

Beutler Lab

Gene Symbol

Pik3cb

Ensembl Gene

ENSMUSG00000032462

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta

Synonyms

p110beta, 1110001J02Rik

MMRRC Submission

044275-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R6128 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99036654-99140621 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99064099 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 558 (D558G)

Ref Sequence

ENSEMBL: ENSMUSP00000035037 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]

PDB Structure

CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035037
AA Change: D558G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: D558G

Domain	Start	End	E-Value	Type
PI3K_p85B	35	112	2.44e-50	SMART
PI3K_rbd	174	282	1.88e-42	SMART
low complexity region	305	311	N/A	INTRINSIC
PI3K_C2	315	417	4.64e-33	SMART
PI3Ka	519	705	1.08e-92	SMART
PI3Kc	795	1061	8.75e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136965

SMART Domains

Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

Domain	Start	End	E-Value	Type
PI3K_p85B	35	112	2.44e-50	SMART
PI3K_rbd	174	282	1.88e-42	SMART
low complexity region	305	311	N/A	INTRINSIC
PI3K_C2	315	417	4.64e-33	SMART
Blast:PI3Ka	450	520	1e-37	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
4931408C20Rik	G	A	1: 26,685,425	P225S	probably benign	Het
A430033K04Rik	A	G	5: 138,647,776	H641R	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
AI464131	T	A	4: 41,498,445	N395I	probably damaging	Het
Asah1	C	T	8: 41,354,055	V111M	probably damaging	Het
Ascc3	T	C	10: 50,650,638	L611P	probably damaging	Het
Atl2	C	A	17: 79,865,041		probably null	Het
Bhlhe22	A	T	3: 18,055,823	S346C	probably damaging	Het
Bicc1	T	C	10: 70,940,483		probably null	Het
Bptf	G	T	11: 107,074,690	A1163D	possibly damaging	Het
Bub1b	T	A	2: 118,617,812	C382S	probably benign	Het
Carmil1	A	T	13: 24,013,194	Y158*	probably null	Het
Ccdc175	A	T	12: 72,129,159	I473K	probably benign	Het
Ccdc18	A	G	5: 108,163,759	I444V	possibly damaging	Het
Cep131	T	A	11: 120,065,975	I880F	probably damaging	Het
Ces2e	T	A	8: 104,928,796	I117N	probably benign	Het
Clk2	C	T	3: 89,174,224	T289M	probably damaging	Het
Crocc2	A	T	1: 93,194,401	D672V	probably benign	Het
Cul7	T	A	17: 46,651,662	I73N	probably damaging	Het
Cyp2d12	C	A	15: 82,558,965	D358E	probably benign	Het
Cyp7a1	A	G	4: 6,272,788	S142P	possibly damaging	Het
Daw1	T	A	1: 83,205,926	C232*	probably null	Het
Dhx9	T	C	1: 153,478,089	K195R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dpp3	A	G	19: 4,922,392	V168A	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ercc6l2	T	C	13: 63,853,749	V459A	probably damaging	Het
Erp44	A	T	4: 48,243,493	N38K	probably damaging	Het
Fam135a	A	G	1: 24,030,740		probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fdps	T	C	3: 89,099,433	E117G	possibly damaging	Het
Gbp4	A	C	5: 105,135,164	V80G	possibly damaging	Het
Glt1d1	A	T	5: 127,677,271	D179V	probably damaging	Het
Gtf2a1l	T	A	17: 88,694,658	V314E	probably null	Het
Gzmf	G	T	14: 56,205,986	Y178*	probably null	Het
Hira	C	T	16: 18,932,977	P509S	probably benign	Het
Ifi44	T	C	3: 151,749,186	N134S	probably benign	Het
Igfbp2	T	A	1: 72,824,799	C74S	probably damaging	Het
Il24	A	G	1: 130,885,698	L54P	probably damaging	Het
Ints10	T	C	8: 68,822,252		probably null	Het
Ipo9	A	G	1: 135,390,573	C700R	possibly damaging	Het
Kalrn	T	A	16: 34,212,885	Q469L	probably damaging	Het
Lrp1b	T	G	2: 40,860,655	I2966L	probably benign	Het
Lta	C	A	17: 35,203,841	V169L	possibly damaging	Het
Lyst	T	C	13: 13,759,379	V3554A	possibly damaging	Het
Mobp	A	G	9: 120,168,326		probably benign	Het
Olfr32	A	T	2: 90,138,610	C176*	probably null	Het
Olfr892-ps1	T	C	9: 38,190,003	S93P	probably benign	Het
Olfr959	C	G	9: 39,573,253	R2T	probably benign	Het
Pacs1	A	T	19: 5,152,372		probably null	Het
Phf21a	G	T	2: 92,351,608		probably null	Het
Pick1	T	A	15: 79,239,696	M89K	probably damaging	Het
Pnmal1	A	G	7: 16,960,736	D172G	probably benign	Het
Polr2a	A	C	11: 69,736,977	V1368G	probably damaging	Het
Pomt2	A	G	12: 87,111,335		probably null	Het
Pou2f1	T	C	1: 165,875,487		probably benign	Het
Rnf145	T	C	11: 44,555,191	V284A	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr3	C	T	2: 112,954,294		probably null	Het
Scamp1	A	C	13: 94,208,227	L202R	possibly damaging	Het
Snx25	C	T	8: 46,105,203	V110I	probably benign	Het
Susd6	T	A	12: 80,868,614	H124Q	possibly damaging	Het
Tarm1	T	C	7: 3,489,204	T248A	probably benign	Het
Tc2n	A	G	12: 101,709,489	M1T	probably null	Het
Tcerg1	C	A	18: 42,511,498		probably null	Het
Ticrr	C	A	7: 79,693,968	P1194T	probably damaging	Het
Trim31	T	G	17: 36,909,599	V469G	probably benign	Het
Vcp	T	C	4: 42,980,941	E723G	probably benign	Het
Vmn1r177	C	A	7: 23,865,842	S203I	probably damaging	Het
Vmn1r177	T	A	7: 23,865,843	S203C	probably damaging	Het
Vmn1r210	A	T	13: 22,828,107	L3*	probably null	Het
Wdr27	T	A	17: 14,932,534	R104*	probably null	Het
Wnk1	A	C	6: 119,963,786		probably null	Het
Zfp157	A	G	5: 138,455,019	E88G	possibly damaging	Het
Zfp708	A	T	13: 67,074,901	L22Q	probably damaging	Het
Zfp788	T	C	7: 41,650,361	F787S	probably damaging	Het

Other mutations in Pik3cb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Pik3cb	APN	9	99101286	missense	probably damaging	0.96
IGL01354:Pik3cb	APN	9	99064168	missense	possibly damaging	0.83
IGL02132:Pik3cb	APN	9	99071377	missense	probably benign	0.01
IGL02268:Pik3cb	APN	9	99046556	missense	probably benign	0.00
IGL02376:Pik3cb	APN	9	99052352	missense	probably benign	0.00
IGL02378:Pik3cb	APN	9	99062840	missense	probably benign	0.40
IGL02748:Pik3cb	APN	9	99062968	splice site	probably benign
IGL03038:Pik3cb	APN	9	99065597	missense	probably damaging	1.00
IGL03142:Pik3cb	APN	9	99065562	missense	probably benign	0.10
H8786:Pik3cb	UTSW	9	99046559	missense	possibly damaging	0.80
R0071:Pik3cb	UTSW	9	99044865	missense	probably benign	0.02
R0071:Pik3cb	UTSW	9	99044865	missense	probably benign	0.02
R0305:Pik3cb	UTSW	9	99064076	missense	possibly damaging	0.86
R0464:Pik3cb	UTSW	9	99044743	critical splice donor site	probably null
R0635:Pik3cb	UTSW	9	99064218	splice site	probably benign
R1386:Pik3cb	UTSW	9	99064027	missense	possibly damaging	0.90
R1530:Pik3cb	UTSW	9	99053973	missense	probably damaging	0.96
R1802:Pik3cb	UTSW	9	99101289	nonsense	probably null
R1815:Pik3cb	UTSW	9	99093095	missense	possibly damaging	0.93
R2011:Pik3cb	UTSW	9	99105579	nonsense	probably null
R2079:Pik3cb	UTSW	9	99060204	missense	probably benign	0.27
R2153:Pik3cb	UTSW	9	99101244	nonsense	probably null
R2237:Pik3cb	UTSW	9	99041028	missense	probably damaging	1.00
R2238:Pik3cb	UTSW	9	99041028	missense	probably damaging	1.00
R2513:Pik3cb	UTSW	9	99061842	missense	probably damaging	1.00
R3982:Pik3cb	UTSW	9	99046601	missense	probably benign	0.06
R4009:Pik3cb	UTSW	9	99040929	missense	probably damaging	0.98
R4246:Pik3cb	UTSW	9	99101176	splice site	probably null
R4248:Pik3cb	UTSW	9	99101176	splice site	probably null
R4249:Pik3cb	UTSW	9	99101176	splice site	probably null
R4334:Pik3cb	UTSW	9	99061851	missense	probably damaging	1.00
R4544:Pik3cb	UTSW	9	99039759	missense	probably damaging	1.00
R4568:Pik3cb	UTSW	9	99090302	missense	probably benign	0.00
R4571:Pik3cb	UTSW	9	99090257	missense	possibly damaging	0.94
R4595:Pik3cb	UTSW	9	99055406	missense	possibly damaging	0.95
R4599:Pik3cb	UTSW	9	99061764	missense	probably benign	0.15
R4820:Pik3cb	UTSW	9	99073626	missense	probably benign	0.00
R4887:Pik3cb	UTSW	9	99101328	missense	probably damaging	0.99
R4967:Pik3cb	UTSW	9	99105632	missense	probably benign	0.14
R5029:Pik3cb	UTSW	9	99054060	missense	probably damaging	0.98
R5031:Pik3cb	UTSW	9	99071408	missense	probably damaging	1.00
R5394:Pik3cb	UTSW	9	99088663	missense	probably benign
R5769:Pik3cb	UTSW	9	99093159	nonsense	probably null
R6250:Pik3cb	UTSW	9	99094598	missense	probably benign	0.01
R6354:Pik3cb	UTSW	9	99073643	missense	probably benign	0.00
R6370:Pik3cb	UTSW	9	99040934	missense	probably damaging	1.00
R6664:Pik3cb	UTSW	9	99094538	missense	possibly damaging	0.56
R6665:Pik3cb	UTSW	9	99073649	missense	probably benign	0.00
R6751:Pik3cb	UTSW	9	99094521	missense	probably benign
R6781:Pik3cb	UTSW	9	99040992	missense	possibly damaging	0.52
R6869:Pik3cb	UTSW	9	99060259	missense	probably benign	0.08
R6883:Pik3cb	UTSW	9	99101400	missense	probably benign	0.00
R7150:Pik3cb	UTSW	9	99093090	missense	probably damaging	1.00
R7446:Pik3cb	UTSW	9	99046658	missense	probably damaging	1.00
R7679:Pik3cb	UTSW	9	99088607	missense	probably benign	0.05
R7831:Pik3cb	UTSW	9	99088613	missense	probably benign
R8300:Pik3cb	UTSW	9	99046658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGAAATACTTCTGCGGAAAGAC -3'
(R):5'- ATTTGCTGAACGGTTGCAC -3'

Sequencing Primer
(F):5'- CTTCTGCGGAAAGACATTTTACAC -3'
(R):5'- CTGAACGGTTGCACAGTTAAATTCC -3'

Posted On

2017-10-10