Incidental Mutation 'R0524:Rgr'
ID 48803
Institutional Source Beutler Lab
Gene Symbol Rgr
Ensembl Gene ENSMUSG00000021804
Gene Name retinal G protein coupled receptor
Synonyms RGR opsin
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R0524 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 36756866-36770921 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36760252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 273 (C273S)
Ref Sequence ENSEMBL: ENSMUSP00000022338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022338] [ENSMUST00000225070] [ENSMUST00000225229] [ENSMUST00000225403]
AlphaFold Q9Z2B3
Predicted Effect probably benign
Transcript: ENSMUST00000022338
AA Change: C273S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022338
Gene: ENSMUSG00000021804
AA Change: C273S

DomainStartEndE-ValueType
Pfam:7tm_1 33 215 2.8e-24 PFAM
low complexity region 227 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224506
Predicted Effect probably benign
Transcript: ENSMUST00000225070
Predicted Effect probably benign
Transcript: ENSMUST00000225229
Predicted Effect probably benign
Transcript: ENSMUST00000225403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225634
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: The gene is a member of the opsin family of G-protein coupled receptors. The encoded protein is expressed in the retina, and acts as a photoisomerase to catalyze the conversion of all-trans-retinal to 11-cis-retinal. Disruption of a similar gene in human is associated with autosomal recessive (arRP) and autosomal dominant retinitis pigmentosa (adRP). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for a targeted null mutation, following 8 hours of light, exhibit reductions in both total retinal (mostly 11-cis-retinal) and rhodopsin levels, and over-accumulate all-trans-retinal indicating an impaired visual cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
Gsr G A 8: 34,159,208 (GRCm39) probably null Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Rgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Rgr APN 14 36,760,875 (GRCm39) nonsense probably null
IGL01462:Rgr APN 14 36,766,566 (GRCm39) missense probably damaging 1.00
R0211:Rgr UTSW 14 36,768,925 (GRCm39) missense probably damaging 1.00
R0211:Rgr UTSW 14 36,768,925 (GRCm39) missense probably damaging 1.00
R0635:Rgr UTSW 14 36,760,904 (GRCm39) nonsense probably null
R1450:Rgr UTSW 14 36,766,641 (GRCm39) nonsense probably null
R1460:Rgr UTSW 14 36,767,683 (GRCm39) missense probably damaging 1.00
R1520:Rgr UTSW 14 36,766,672 (GRCm39) missense probably damaging 1.00
R2114:Rgr UTSW 14 36,760,809 (GRCm39) splice site probably null
R7133:Rgr UTSW 14 36,770,882 (GRCm39) start codon destroyed probably null 1.00
R7699:Rgr UTSW 14 36,766,552 (GRCm39) missense probably damaging 1.00
R7700:Rgr UTSW 14 36,766,552 (GRCm39) missense probably damaging 1.00
R7978:Rgr UTSW 14 36,766,645 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGCATCTTCCTGACCTCTGAC -3'
(R):5'- GAGACCTGGGGCTGAAATTGACAC -3'

Sequencing Primer
(F):5'- TGACCTGGGGCATACTTAAC -3'
(R):5'- CTGATGACATACAGGGGTTCTATGAC -3'
Posted On 2013-06-12