Mutagenetix > Incidental Mutation

Incidental Mutation 'R0524:Slc34a2'

48775

Institutional Source

Beutler Lab

Gene Symbol

Slc34a2

Ensembl Gene

ENSMUSG00000029188

Gene Name

solute carrier family 34 (sodium phosphate), member 2

Synonyms

D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b

MMRRC Submission

038717-MU

Accession Numbers

Genbank: NM_011402; MGI: 1342284

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0524 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53038081-53071664 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 53064873 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 302 (W302*)

Ref Sequence

ENSEMBL: ENSMUSP00000092380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094787] [ENSMUST00000170523]

AlphaFold

Q9DBP0

Predicted Effect

probably null
Transcript: ENSMUST00000094787
AA Change: W302*

SMART Domains

Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: W302*

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	252	2.3e-26	PFAM
Pfam:Na_Pi_cotrans	374	551	2.6e-17	PFAM
low complexity region	553	570	N/A	INTRINSIC
low complexity region	616	645	N/A	INTRINSIC
low complexity region	649	655	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147243

Predicted Effect

probably benign
Transcript: ENSMUST00000170523

SMART Domains

Protein: ENSMUSP00000130692
Gene: ENSMUSG00000029188

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	187	2.9e-20	PFAM

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.4%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	CGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGA	1: 180,747,059		probably benign	Het
Adamts16	T	C	13: 70,800,894	E216G	probably benign	Het
Aoc3	C	A	11: 101,337,511	P715T	probably damaging	Het
Bnipl	T	C	3: 95,249,829	D33G	probably benign	Het
Celsr2	T	C	3: 108,401,587	H1701R	probably damaging	Het
Clca3b	T	A	3: 144,825,321	H756L	probably benign	Het
Clca4a	A	G	3: 144,969,393	W159R	probably damaging	Het
Ddx49	A	T	8: 70,296,924	I252N	probably damaging	Het
Duox2	T	C	2: 122,281,836	T1290A	possibly damaging	Het
Fam111a	T	A	19: 12,588,048	I431K	probably damaging	Het
Fam135b	A	T	15: 71,462,284	D1020E	probably benign	Het
Flii	A	G	11: 60,720,061	V514A	probably damaging	Het
Frmpd1	G	A	4: 45,256,902	V157M	probably damaging	Het
Frmpd1	A	G	4: 45,283,774	D865G	probably benign	Het
Gm6970	T	A	19: 47,170,494	K214M	unknown	Het
Gsr	G	A	8: 33,669,180		probably null	Het
Hps3	A	T	3: 20,012,776	V542E	probably damaging	Het
Kcnj5	A	G	9: 32,322,974	I15T	probably benign	Het
Kif2b	T	C	11: 91,575,724	R578G	probably benign	Het
Lamb2	A	G	9: 108,484,372	R676G	possibly damaging	Het
Mrpl40	A	G	16: 18,873,552	F94S	possibly damaging	Het
Myo7b	C	T	18: 32,013,424	V103M	possibly damaging	Het
Nmt2	T	A	2: 3,305,437	W69R	probably benign	Het
Nsd3	C	A	8: 25,700,577	Q1130K	possibly damaging	Het
Olfml1	T	C	7: 107,590,177	S150P	probably damaging	Het
Olfr123	A	T	17: 37,795,605	K54*	probably null	Het
Olfr1471	A	G	19: 13,445,864	N284S	probably damaging	Het
Pask	A	T	1: 93,310,834	W1310R	probably damaging	Het
Pcdh18	T	C	3: 49,755,642	Q408R	probably damaging	Het
Pfkm	A	G	15: 98,131,607	I700V	probably benign	Het
Pias1	A	G	9: 62,952,178	V16A	probably damaging	Het
Pnpla8	C	T	12: 44,283,618	Q318*	probably null	Het
Ppp1cc	C	T	5: 122,172,770	R142*	probably null	Het
Pygl	T	A	12: 70,207,724	N149I	probably damaging	Het
Rapgef6	T	A	11: 54,690,284	S1285T	probably benign	Het
Rdh13	A	C	7: 4,444,297	C10W	probably damaging	Het
Rgr	A	T	14: 37,038,295	C273S	probably benign	Het
Ripk4	G	T	16: 97,755,287	Y22*	probably null	Het
Smarce1	G	A	11: 99,214,062	T263M	probably damaging	Het
Sypl	C	T	12: 32,967,565	P94L	possibly damaging	Het
Tet3	A	G	6: 83,379,942	I878T	probably damaging	Het
Tmem232	A	G	17: 65,485,942	S87P	probably damaging	Het
Tmem260	A	G	14: 48,472,478	T163A	probably benign	Het
Ttn	T	C	2: 76,725,452	Y30403C	probably damaging	Het
Ubash3b	A	T	9: 41,016,608	M468K	probably benign	Het
Ulk4	A	G	9: 121,252,651		probably null	Het
Vmn1r72	A	G	7: 11,669,792	F243S	probably benign	Het
Wrap73	A	G	4: 154,145,307	Y45C	probably damaging	Het
Zfp704	T	C	3: 9,609,364	D119G	unknown	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Slc34a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Slc34a2	APN	5	53065608	missense	probably benign	0.06
IGL00845:Slc34a2	APN	5	53058354	splice site	probably benign
IGL01024:Slc34a2	APN	5	53067630	missense	possibly damaging	0.61
IGL01300:Slc34a2	APN	5	53068127	critical splice acceptor site	probably null
IGL01680:Slc34a2	APN	5	53060876	missense	probably damaging	1.00
IGL02226:Slc34a2	APN	5	53067731	missense	probably benign	0.12
IGL02682:Slc34a2	APN	5	53059238	missense	possibly damaging	0.64
IGL03294:Slc34a2	APN	5	53063998	missense	probably benign	0.00
tucumcari	UTSW	5	53064009	missense	possibly damaging	0.68
D4216:Slc34a2	UTSW	5	53065497	missense	probably benign	0.01
R0094:Slc34a2	UTSW	5	53063968	missense	probably benign	0.28
R0227:Slc34a2	UTSW	5	53069626	missense	possibly damaging	0.51
R0836:Slc34a2	UTSW	5	53067707	missense	probably benign
R1525:Slc34a2	UTSW	5	53069506	missense	probably benign	0.00
R1655:Slc34a2	UTSW	5	53069419	missense	probably benign	0.00
R1753:Slc34a2	UTSW	5	53061391	missense	probably benign	0.37
R1838:Slc34a2	UTSW	5	53058436	missense	probably benign
R2361:Slc34a2	UTSW	5	53068145	missense	probably benign	0.10
R2405:Slc34a2	UTSW	5	53058181	missense	probably benign	0.04
R3688:Slc34a2	UTSW	5	53064832	missense	probably benign	0.06
R4108:Slc34a2	UTSW	5	53064009	missense	possibly damaging	0.68
R4176:Slc34a2	UTSW	5	53067568	missense	probably damaging	1.00
R4380:Slc34a2	UTSW	5	53069286	missense	probably damaging	1.00
R4464:Slc34a2	UTSW	5	53069182	missense	probably damaging	0.99
R4780:Slc34a2	UTSW	5	53069451	missense	probably damaging	1.00
R4816:Slc34a2	UTSW	5	53069020	missense	probably damaging	1.00
R4934:Slc34a2	UTSW	5	53067600	missense	probably damaging	1.00
R5265:Slc34a2	UTSW	5	53061434	missense	probably damaging	0.96
R5309:Slc34a2	UTSW	5	53069488	missense	probably damaging	0.96
R5313:Slc34a2	UTSW	5	53069339	missense	probably damaging	0.96
R5884:Slc34a2	UTSW	5	53069380	missense	possibly damaging	0.46
R6084:Slc34a2	UTSW	5	53067647	missense	possibly damaging	0.91
R6310:Slc34a2	UTSW	5	53064797	critical splice acceptor site	probably null
R6568:Slc34a2	UTSW	5	53069134	missense	probably damaging	1.00
R6817:Slc34a2	UTSW	5	53064028	missense	probably damaging	0.98
R6845:Slc34a2	UTSW	5	53069169	missense	probably damaging	0.96
R6944:Slc34a2	UTSW	5	53064883	missense	probably benign
R7873:Slc34a2	UTSW	5	53058372	missense	probably benign	0.02
R8114:Slc34a2	UTSW	5	53068359	missense	probably benign	0.00
R8158:Slc34a2	UTSW	5	53060840	missense	probably damaging	1.00
R8364:Slc34a2	UTSW	5	53068374	missense	possibly damaging	0.75
R9158:Slc34a2	UTSW	5	53063875	missense	possibly damaging	0.95
R9235:Slc34a2	UTSW	5	53069325	missense	probably benign	0.00
R9314:Slc34a2	UTSW	5	53060801	missense	possibly damaging	0.61
Z1176:Slc34a2	UTSW	5	53060817	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTCCAGTGGCTCACATTCACAG -3'
(R):5'- AGATCACGGTCTCCAAAGCAAAAGG -3'

Sequencing Primer
(F):5'- GCTCACATTCACAGCACCC -3'
(R):5'- GCAAGAGTCATCCTTCCATGAG -3'

Posted On

2013-06-12