Incidental Mutation 'R0524:Gsr'
ID 48783
Institutional Source Beutler Lab
Gene Symbol Gsr
Ensembl Gene ENSMUSG00000031584
Gene Name glutathione reductase
Synonyms D8Ertd238e, Gr-1, Gr1
MMRRC Submission 038717-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.213) question?
Stock # R0524 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 34143266-34188190 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 34159208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033992]
AlphaFold P47791
Predicted Effect probably null
Transcript: ENSMUST00000033992
SMART Domains Protein: ENSMUSP00000033992
Gene: ENSMUSG00000031584

DomainStartEndE-ValueType
low complexity region 17 22 N/A INTRINSIC
Pfam:Pyr_redox_2 43 368 1.2e-73 PFAM
Pfam:Pyr_redox 211 292 1.7e-21 PFAM
Pfam:Pyr_redox_dim 389 500 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154745
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. This enzyme is a homodimeric flavoprotein. It is a central enzyme of cellular antioxidant defense, and reduces oxidized glutathione disulfide (GSSG) to the sulfhydryl form GSH, which is an important cellular antioxidant. Rare mutations in this gene result in hereditary glutathione reductase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2010]
PHENOTYPE: A homozygous mutation disrupting this gene between exon 1-2 results in a decreased retinal artery-to-vein ratio. Another small deletion of exons 2-5 has no phenotypic effect. Electrophoretic alleles designated a (C57BL/6, CE) vs. allele b (SJL, SWR) are known. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,574,624 (GRCm39) probably benign Het
Adamts16 T C 13: 70,949,013 (GRCm39) E216G probably benign Het
Aoc3 C A 11: 101,228,337 (GRCm39) P715T probably damaging Het
Bnipl T C 3: 95,157,140 (GRCm39) D33G probably benign Het
Celsr2 T C 3: 108,308,903 (GRCm39) H1701R probably damaging Het
Clca3b T A 3: 144,531,082 (GRCm39) H756L probably benign Het
Clca4a A G 3: 144,675,154 (GRCm39) W159R probably damaging Het
Ddx49 A T 8: 70,749,574 (GRCm39) I252N probably damaging Het
Duox2 T C 2: 122,112,317 (GRCm39) T1290A possibly damaging Het
Fam111a T A 19: 12,565,412 (GRCm39) I431K probably damaging Het
Fam135b A T 15: 71,334,133 (GRCm39) D1020E probably benign Het
Flii A G 11: 60,610,887 (GRCm39) V514A probably damaging Het
Frmpd1 A G 4: 45,283,774 (GRCm39) D865G probably benign Het
Frmpd1 G A 4: 45,256,902 (GRCm39) V157M probably damaging Het
H1f11-ps T A 19: 47,158,933 (GRCm39) K214M unknown Het
Hps3 A T 3: 20,066,940 (GRCm39) V542E probably damaging Het
Kcnj5 A G 9: 32,234,270 (GRCm39) I15T probably benign Het
Kif2b T C 11: 91,466,550 (GRCm39) R578G probably benign Het
Lamb2 A G 9: 108,361,571 (GRCm39) R676G possibly damaging Het
Mrpl40 A G 16: 18,692,302 (GRCm39) F94S possibly damaging Het
Myo7b C T 18: 32,146,477 (GRCm39) V103M possibly damaging Het
Nmt2 T A 2: 3,306,474 (GRCm39) W69R probably benign Het
Nsd3 C A 8: 26,190,605 (GRCm39) Q1130K possibly damaging Het
Olfml1 T C 7: 107,189,384 (GRCm39) S150P probably damaging Het
Or2g1 A T 17: 38,106,496 (GRCm39) K54* probably null Het
Or5b116 A G 19: 13,423,228 (GRCm39) N284S probably damaging Het
Pask A T 1: 93,238,556 (GRCm39) W1310R probably damaging Het
Pcdh18 T C 3: 49,710,091 (GRCm39) Q408R probably damaging Het
Pfkm A G 15: 98,029,488 (GRCm39) I700V probably benign Het
Pias1 A G 9: 62,859,460 (GRCm39) V16A probably damaging Het
Pnpla8 C T 12: 44,330,401 (GRCm39) Q318* probably null Het
Ppp1cc C T 5: 122,310,833 (GRCm39) R142* probably null Het
Pygl T A 12: 70,254,498 (GRCm39) N149I probably damaging Het
Rapgef6 T A 11: 54,581,110 (GRCm39) S1285T probably benign Het
Rdh13 A C 7: 4,447,296 (GRCm39) C10W probably damaging Het
Rgr A T 14: 36,760,252 (GRCm39) C273S probably benign Het
Ripk4 G T 16: 97,556,487 (GRCm39) Y22* probably null Het
Slc34a2 G A 5: 53,222,215 (GRCm39) W302* probably null Het
Smarce1 G A 11: 99,104,888 (GRCm39) T263M probably damaging Het
Sypl1 C T 12: 33,017,564 (GRCm39) P94L possibly damaging Het
Tet3 A G 6: 83,356,924 (GRCm39) I878T probably damaging Het
Tmem232 A G 17: 65,792,937 (GRCm39) S87P probably damaging Het
Tmem260 A G 14: 48,709,935 (GRCm39) T163A probably benign Het
Ttn T C 2: 76,555,796 (GRCm39) Y30403C probably damaging Het
Ubash3b A T 9: 40,927,904 (GRCm39) M468K probably benign Het
Ulk4 A G 9: 121,081,717 (GRCm39) probably null Het
Vmn1r72 A G 7: 11,403,719 (GRCm39) F243S probably benign Het
Wrap73 A G 4: 154,229,764 (GRCm39) Y45C probably damaging Het
Zfp704 T C 3: 9,674,424 (GRCm39) D119G unknown Het
Zfp719 A G 7: 43,238,677 (GRCm39) probably null Het
Other mutations in Gsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Gsr APN 8 34,172,612 (GRCm39) splice site probably benign
IGL02481:Gsr APN 8 34,175,569 (GRCm39) splice site probably benign
IGL02941:Gsr APN 8 34,179,453 (GRCm39) missense probably damaging 0.98
IGL03242:Gsr APN 8 34,175,627 (GRCm39) missense probably benign
IGL03293:Gsr APN 8 34,185,024 (GRCm39) splice site probably benign
R0208:Gsr UTSW 8 34,179,383 (GRCm39) missense possibly damaging 0.45
R0490:Gsr UTSW 8 34,161,540 (GRCm39) splice site probably benign
R0492:Gsr UTSW 8 34,171,603 (GRCm39) splice site probably benign
R1104:Gsr UTSW 8 34,159,949 (GRCm39) missense probably damaging 1.00
R1976:Gsr UTSW 8 34,170,288 (GRCm39) splice site probably null
R2507:Gsr UTSW 8 34,170,316 (GRCm39) missense probably benign 0.45
R2508:Gsr UTSW 8 34,170,316 (GRCm39) missense probably benign 0.45
R3726:Gsr UTSW 8 34,161,565 (GRCm39) missense probably benign 0.11
R4573:Gsr UTSW 8 34,183,881 (GRCm39) missense probably benign 0.00
R4623:Gsr UTSW 8 34,170,333 (GRCm39) missense probably damaging 0.99
R4639:Gsr UTSW 8 34,187,284 (GRCm39) missense probably damaging 1.00
R4713:Gsr UTSW 8 34,170,347 (GRCm39) critical splice donor site probably null
R4717:Gsr UTSW 8 34,183,886 (GRCm39) nonsense probably null
R4992:Gsr UTSW 8 34,183,941 (GRCm39) missense probably damaging 1.00
R5099:Gsr UTSW 8 34,161,556 (GRCm39) missense probably damaging 1.00
R6019:Gsr UTSW 8 34,183,835 (GRCm39) missense probably damaging 0.97
R7046:Gsr UTSW 8 34,185,090 (GRCm39) missense probably damaging 1.00
R7570:Gsr UTSW 8 34,159,193 (GRCm39) missense probably damaging 1.00
R8955:Gsr UTSW 8 34,183,936 (GRCm39) missense possibly damaging 0.78
R9362:Gsr UTSW 8 34,179,406 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCGCTCGTTCATGCAGG -3'
(R):5'- CCAGGAACTGTGAGCTGTGATCTAAAA -3'

Sequencing Primer
(F):5'- caacccacccactctcac -3'
(R):5'- tgtgagctgtgatctaaaataaacc -3'
Posted On 2013-06-12