Mutagenetix > Incidental Mutations

Incidental Mutation 'R0526:Tnks'

48928

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

MMRRC Submission

038719-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0526 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34853303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 738 (V738E)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

AlphaFold

Q6PFX9

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000033929
AA Change: V738E

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: V738E

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209904

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	T	4: 137,455,224	N230I	possibly damaging	Het
4933427D14Rik	G	T	11: 72,169,783	Q687K	probably damaging	Het
Actrt2	A	G	4: 154,667,412	L89P	probably damaging	Het
Adamts1	A	C	16: 85,802,372	S113R	probably benign	Het
Agxt2	G	T	15: 10,373,862	C118F	probably damaging	Het
Akap8	G	A	17: 32,317,292	T49I	probably benign	Het
Alk	A	T	17: 71,869,753	W1519R	probably damaging	Het
Atf7ip	T	A	6: 136,559,805	F12Y	probably damaging	Het
Atp13a5	A	G	16: 29,348,740	C131R	probably damaging	Het
Atp8b4	A	G	2: 126,427,363	L168P	probably damaging	Het
Blm	G	T	7: 80,505,893	S346*	probably null	Het
Ccnt2	T	G	1: 127,799,445	C199G	probably damaging	Het
Cd151	A	T	7: 141,470,591	H219L	probably damaging	Het
Cd200r2	A	T	16: 44,915,047	R248S	probably damaging	Het
Cdh3	A	G	8: 106,555,446	D822G	possibly damaging	Het
Clec4b1	T	C	6: 123,069,770		probably null	Het
Cluh	C	A	11: 74,665,986	L951I	probably benign	Het
Cog7	A	T	7: 121,963,271		probably null	Het
Col25a1	C	A	3: 130,476,394	P197Q	probably damaging	Het
Csde1	T	A	3: 103,056,426	S636R	possibly damaging	Het
Ect2l	C	A	10: 18,199,940	C66F	possibly damaging	Het
Elac2	T	C	11: 64,999,436	M671T	probably benign	Het
Evi5	T	C	5: 107,821,748	N143S	probably benign	Het
Ext2	A	G	2: 93,806,085	V228A	probably damaging	Het
Fbxo38	A	G	18: 62,505,980	Y1084H	probably damaging	Het
Fcgr4	T	A	1: 171,029,191	L209Q	probably damaging	Het
Fgd3	C	T	13: 49,296,524	S83N	probably benign	Het
Gigyf2	T	A	1: 87,421,493	M664K	probably benign	Het
Gm38394	T	C	1: 133,658,734	I288M	probably damaging	Het
Il27ra	A	T	8: 84,039,499	S219T	probably benign	Het
Kif15	T	C	9: 122,997,797	V800A	probably damaging	Het
Lmo7	T	A	14: 101,900,560	D666E	probably damaging	Het
Lrp5	T	C	19: 3,628,295	D520G	probably damaging	Het
Lrriq3	T	A	3: 155,188,297	M545K	probably benign	Het
Lsm5	T	A	6: 56,703,325	D44V	probably damaging	Het
Man1c1	G	T	4: 134,569,068	Y430*	probably null	Het
Map4	T	A	9: 110,037,278		probably null	Het
Megf6	A	G	4: 154,258,941	K561R	probably benign	Het
Myo1e	T	C	9: 70,322,398	Y173H	probably damaging	Het
Myo6	T	A	9: 80,283,541	S791R	possibly damaging	Het
Nol11	C	A	11: 107,184,771	E144*	probably null	Het
Ntng2	C	T	2: 29,197,062	R416Q	probably damaging	Het
Nxpe3	T	A	16: 55,866,517	I43F	possibly damaging	Het
Olfr1093	A	T	2: 86,786,347	T206S	possibly damaging	Het
Olfr1284	T	A	2: 111,379,492	V164E	possibly damaging	Het
Pkd1l2	T	C	8: 117,082,260	I64V	probably damaging	Het
Prf1	G	A	10: 61,300,254	R103H	probably benign	Het
Rest	A	G	5: 77,281,027	D431G	probably damaging	Het
Serpina10	A	T	12: 103,616,868	L439Q	probably damaging	Het
Sgk3	T	G	1: 9,881,579	V176G	probably damaging	Het
Slc19a3	A	G	1: 83,022,733	S188P	probably damaging	Het
Sorbs1	A	G	19: 40,349,948	I336T	probably damaging	Het
Ssfa2	A	G	2: 79,657,346	D591G	probably benign	Het
Strip1	C	T	3: 107,620,039		probably null	Het
Syt4	T	C	18: 31,443,746	E185G	possibly damaging	Het
Tcaf3	T	A	6: 42,589,804	I784F	probably damaging	Het
Tgfbr3l	G	T	8: 4,249,439	R74L	possibly damaging	Het
Thoc7	A	G	14: 13,949,282	M194T	probably benign	Het
Thsd7b	T	C	1: 129,951,392	Y989H	probably damaging	Het
Tmem156	C	T	5: 65,075,818	V134I	probably benign	Het
Trpm6	A	T	19: 18,792,876	I342F	probably damaging	Het
Vmn2r69	A	T	7: 85,411,503	V291D	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Wnk1	T	C	6: 119,951,992	T1292A	probably damaging	Het
Yes1	T	A	5: 32,655,240	C285S	probably benign	Het
Zbtb49	T	C	5: 38,213,919	N206S	probably benign	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
R8870:Tnks	UTSW	8	34847279	critical splice donor site	probably null
R8936:Tnks	UTSW	8	34853347	nonsense	probably null
R9049:Tnks	UTSW	8	34841778	missense	probably damaging	0.96
R9080:Tnks	UTSW	8	34965312	small deletion	probably benign
R9182:Tnks	UTSW	8	34841751	critical splice donor site	probably null
R9211:Tnks	UTSW	8	34849335	missense	probably damaging	1.00
R9425:Tnks	UTSW	8	34873665	missense	probably damaging	1.00
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CCTTCTTGGGTGAAATGTCCCCAC -3'
(R):5'- AGAGTCTCACATAGGCTGTGCTGG -3'

Sequencing Primer
(F):5'- GGGTGAAATGTCCCCACTTAGTC -3'
(R):5'- ctgacctcctgcctttacc -3'

Posted On

2013-06-12