Incidental Mutation 'R5959:Sorcs3'
ID 501676
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 044146-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R5959 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 48737835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 751 (C751G)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect probably damaging
Transcript: ENSMUST00000078880
AA Change: C751G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: C751G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,106,792 (GRCm39) N164Y probably damaging Het
Acp6 A G 3: 97,073,888 (GRCm39) E164G probably damaging Het
Adcy5 A T 16: 35,118,780 (GRCm39) I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,173 (GRCm39) D363G probably damaging Het
Ankrd28 T C 14: 31,451,879 (GRCm39) T273A probably benign Het
Cc2d1a A T 8: 84,860,132 (GRCm39) Y862* probably null Het
Cfap221 T A 1: 119,860,511 (GRCm39) H705L probably damaging Het
Cfap61 C T 2: 145,789,053 (GRCm39) T19M probably benign Het
Chga T C 12: 102,528,114 (GRCm39) S202P probably benign Het
Cnmd T C 14: 79,894,109 (GRCm39) I93V probably damaging Het
Cpne1 G A 2: 155,920,143 (GRCm39) S188L probably benign Het
Dchs2 G A 3: 83,232,725 (GRCm39) V2237I probably benign Het
Dguok C T 6: 83,467,574 (GRCm39) R91H probably benign Het
Eed A G 7: 89,618,835 (GRCm39) I193T probably damaging Het
Fasn C T 11: 120,699,390 (GRCm39) E2353K probably damaging Het
Fpr-rs7 G A 17: 20,334,011 (GRCm39) H160Y probably benign Het
Gramd4 T A 15: 86,011,758 (GRCm39) M272K probably damaging Het
Hfm1 A G 5: 107,022,783 (GRCm39) S940P probably damaging Het
Ifnlr1 T A 4: 135,432,652 (GRCm39) S363T possibly damaging Het
Jak3 A G 8: 72,134,715 (GRCm39) N481D probably damaging Het
Kcnj3 A G 2: 55,327,330 (GRCm39) K40E probably benign Het
Kif20a G A 18: 34,765,468 (GRCm39) A822T probably benign Het
Lpcat4 T A 2: 112,070,380 (GRCm39) L31H possibly damaging Het
Myo1c A G 11: 75,548,345 (GRCm39) T38A probably benign Het
Myt1l T C 12: 29,970,039 (GRCm39) probably null Het
Nbas T C 12: 13,338,802 (GRCm39) V214A probably damaging Het
Neb C A 2: 52,046,389 (GRCm39) R6537L probably benign Het
Nwd2 T A 5: 63,965,413 (GRCm39) F1666I probably benign Het
Or52z1 T A 7: 103,436,723 (GRCm39) I254F probably damaging Het
Or8b1 A G 9: 38,400,207 (GRCm39) N294S probably damaging Het
Prmt8 C A 6: 127,706,381 (GRCm39) V137L probably damaging Het
Ptpn21 A T 12: 98,675,148 (GRCm39) probably null Het
Rab15 A G 12: 76,869,043 (GRCm39) S17P probably damaging Het
Rbm5 T G 9: 107,629,339 (GRCm39) I338L probably benign Het
Rragc G A 4: 123,817,767 (GRCm39) S218N probably damaging Het
Sacs T C 14: 61,449,849 (GRCm39) M3965T probably damaging Het
Sgo2b T A 8: 64,380,322 (GRCm39) I837F probably benign Het
Sowahc A G 10: 59,058,920 (GRCm39) D352G probably benign Het
Sox15 C T 11: 69,546,556 (GRCm39) R120C probably damaging Het
Spata31f1e T A 4: 42,793,492 (GRCm39) K213N probably damaging Het
Srr A G 11: 74,801,891 (GRCm39) V126A possibly damaging Het
Tenm3 T A 8: 49,099,482 (GRCm39) R108* probably null Het
Traf3ip2 A T 10: 39,517,337 (GRCm39) M403L probably benign Het
Trappc11 T C 8: 47,954,593 (GRCm39) D949G probably damaging Het
Ttn A G 2: 76,544,960 (GRCm39) I32714T probably damaging Het
Ttn T A 2: 76,693,849 (GRCm39) T218S possibly damaging Het
Uaca A T 9: 60,778,052 (GRCm39) H811L probably damaging Het
Ugt2b1 T C 5: 87,073,813 (GRCm39) E182G probably benign Het
Vmn1r49 T C 6: 90,049,786 (GRCm39) D72G probably damaging Het
Vmn2r80 A T 10: 79,005,313 (GRCm39) M317L probably benign Het
Vwa2 T C 19: 56,869,604 (GRCm39) L13P possibly damaging Het
Zc3hav1 G A 6: 38,284,379 (GRCm39) T912I probably benign Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Zfp948 A G 17: 21,807,776 (GRCm39) K323E probably benign Het
Zfyve27 T G 19: 42,167,887 (GRCm39) V143G unknown Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCAAGTCTTTTGTTGACC -3'
(R):5'- GCCATTCCCCATCAATGTGC -3'

Sequencing Primer
(F):5'- GGCAAGTCTTTTGTTGACCAACTAG -3'
(R):5'- CCATCAATGTGCCCCAGTC -3'
Posted On 2017-12-01