Incidental Mutation 'R0709:Sorcs3'
ID 216243
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R0709 (G1)
Quality Score 55
Status Validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 48475845 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 235 (A235T)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect probably benign
Transcript: ENSMUST00000078880
AA Change: A235T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: A235T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGCTCCAGCAGCTTCTTTC -3'
(R):5'- CTCTCCACAAGTGGTATGATCGCC -3'

Sequencing Primer
(F):5'- GGAAGAAGGCACATTAGTCTAATTTC -3'
(R):5'- AGTGGTATGATCGCCGTTGTG -3'
Posted On 2014-07-31