Incidental Mutation 'R0456:Sorcs3'
ID 40063
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 038656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R0456 (G1)
Quality Score 164
Status Not validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48642483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 379 (S379C)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect possibly damaging
Transcript: ENSMUST00000078880
AA Change: S379C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: S379C

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,429,036 (GRCm39) P11L probably damaging Het
Antxr1 A C 6: 87,194,257 (GRCm39) V347G probably damaging Het
Atp13a5 T C 16: 29,051,492 (GRCm39) N1127D probably benign Het
Bivm T A 1: 44,165,969 (GRCm39) W140R probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ceacam5 T C 7: 17,494,776 (GRCm39) V928A possibly damaging Het
Chia1 T C 3: 106,035,795 (GRCm39) Y152H probably damaging Het
Chsy3 A T 18: 59,309,550 (GRCm39) I268F probably damaging Het
CK137956 A T 4: 127,839,100 (GRCm39) N439K probably damaging Het
Csf3r C A 4: 125,929,654 (GRCm39) N392K probably damaging Het
Cyp1b1 T C 17: 80,017,704 (GRCm39) I484V probably benign Het
Dsc1 T C 18: 20,232,169 (GRCm39) K280E probably damaging Het
Eefsec A G 6: 88,274,870 (GRCm39) Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 (GRCm39) probably null Het
Erap1 G A 13: 74,812,339 (GRCm39) V385I probably benign Het
Fat1 A T 8: 45,482,571 (GRCm39) I3077F probably damaging Het
Fras1 T G 5: 96,862,202 (GRCm39) probably null Het
Fras1 G T 5: 96,702,647 (GRCm39) G230C probably damaging Het
Gsg1l A G 7: 125,522,682 (GRCm39) M182T possibly damaging Het
Gzmg A G 14: 56,395,779 (GRCm39) V60A probably damaging Het
H4c6 T C 13: 23,735,561 (GRCm39) D86G probably damaging Het
Hapln4 A T 8: 70,537,645 (GRCm39) Y113F probably benign Het
Ikzf4 T A 10: 128,471,677 (GRCm39) T274S probably damaging Het
Kansl1l T A 1: 66,774,885 (GRCm39) H302L probably damaging Het
Klhl41 T C 2: 69,500,893 (GRCm39) V118A probably damaging Het
Kpna1 T C 16: 35,823,270 (GRCm39) S41P possibly damaging Het
Krt23 A G 11: 99,377,604 (GRCm39) V134A probably benign Het
Lamb1 G A 12: 31,354,729 (GRCm39) C992Y probably damaging Het
Lrif1 C T 3: 106,639,094 (GRCm39) P35S probably benign Het
Lrrc4 A G 6: 28,831,103 (GRCm39) S171P probably damaging Het
Lvrn G A 18: 46,997,883 (GRCm39) probably null Het
Matr3 T A 18: 35,705,917 (GRCm39) F281I probably damaging Het
Meak7 A T 8: 120,495,162 (GRCm39) F199I probably damaging Het
Nxn G A 11: 76,153,963 (GRCm39) Q291* probably null Het
Or5b113 A G 19: 13,342,102 (GRCm39) T37A probably damaging Het
Pdp2 G T 8: 105,320,421 (GRCm39) R90L probably damaging Het
Ppp1r3c C A 19: 36,711,291 (GRCm39) E160* probably null Het
Ppp2r5c T G 12: 110,489,013 (GRCm39) S118R probably damaging Het
Ptpn23 G T 9: 110,218,861 (GRCm39) probably null Het
Ptpro G T 6: 137,391,228 (GRCm39) V783L probably benign Het
Rab40c A G 17: 26,103,631 (GRCm39) V144A possibly damaging Het
Rasal2 T C 1: 156,977,413 (GRCm39) N1087S probably damaging Het
Rfc3 T A 5: 151,570,988 (GRCm39) S103C possibly damaging Het
Rgl2 A G 17: 34,155,823 (GRCm39) probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rit2 A T 18: 31,108,504 (GRCm39) F160L probably benign Het
Rnh1 A G 7: 140,742,461 (GRCm39) S366P possibly damaging Het
Sdk2 T C 11: 113,682,292 (GRCm39) Y2029C possibly damaging Het
Smpd3 T A 8: 106,986,288 (GRCm39) I505F probably benign Het
Sult1e1 A G 5: 87,726,493 (GRCm39) L207P possibly damaging Het
Sycp2 C G 2: 178,023,648 (GRCm39) S456T probably benign Het
Syne1 T C 10: 5,292,252 (GRCm39) T1339A probably benign Het
Tas2r117 A G 6: 132,780,354 (GRCm39) N164S probably benign Het
Tigd3 A G 19: 5,942,821 (GRCm39) L103P probably damaging Het
Tmem132b T C 5: 125,864,788 (GRCm39) S965P probably damaging Het
Tmem82 T C 4: 141,344,701 (GRCm39) T81A probably benign Het
Tmem8b A G 4: 43,685,618 (GRCm39) T156A probably benign Het
Tnfrsf21 A G 17: 43,348,982 (GRCm39) E198G probably benign Het
Tnpo2 A G 8: 85,781,045 (GRCm39) N767S probably damaging Het
Trf T C 9: 103,104,102 (GRCm39) Y87C probably damaging Het
Tst A G 15: 78,289,780 (GRCm39) V85A probably damaging Het
Usp37 A T 1: 74,507,507 (GRCm39) N503K probably damaging Het
Utp20 C T 10: 88,590,435 (GRCm39) M2346I possibly damaging Het
Vax2 A G 6: 83,688,388 (GRCm39) D37G probably benign Het
Vmn1r77 T A 7: 11,775,665 (GRCm39) L79* probably null Het
Zbtb3 A T 19: 8,780,564 (GRCm39) D59V probably damaging Het
Zdhhc13 T C 7: 48,458,602 (GRCm39) F182S probably benign Het
Zfp426 A G 9: 20,381,593 (GRCm39) F465L probably damaging Het
Zfp526 A G 7: 24,925,637 (GRCm39) E632G probably damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,748,296 (GRCm39) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACTTATCATCTGAGGTTTGGTTGT -3'
(R):5'- TGCTCCACACCTTCAAGTTCCCA -3'

Sequencing Primer
(F):5'- cccaatgaacatttccgcc -3'
(R):5'- ACACCTTCAAGTTCCCAGGTATG -3'
Posted On 2013-05-23