Incidental Mutation 'R6369:Rnf224'
ID 512834
Institutional Source Beutler Lab
Gene Symbol Rnf224
Ensembl Gene ENSMUSG00000089953
Gene Name ring finger protein 224
Synonyms Gm757, LOC329360
MMRRC Submission 044519-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6369 (G1)
Quality Score 223.009
Status Validated
Chromosome 2
Chromosomal Location 25124488-25126799 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25125954 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 133 (F133S)
Ref Sequence ENSEMBL: ENSMUSP00000145127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000043379] [ENSMUST00000091318] [ENSMUST00000114356] [ENSMUST00000205192] [ENSMUST00000186719]
AlphaFold Q3UIW8
Predicted Effect probably benign
Transcript: ENSMUST00000006638
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043379
SMART Domains Protein: ENSMUSP00000045363
Gene: ENSMUSG00000036731

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.2e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091318
AA Change: F133S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088868
Gene: ENSMUSG00000089953
AA Change: F133S

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091318
AA Change: F133S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145470
Gene: ENSMUSG00000089953
AA Change: F133S

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114356
SMART Domains Protein: ENSMUSP00000109996
Gene: ENSMUSG00000036731

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.3e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137482
Predicted Effect probably damaging
Transcript: ENSMUST00000205192
AA Change: F133S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145127
Gene: ENSMUSG00000089953
AA Change: F133S

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186719
SMART Domains Protein: ENSMUSP00000140416
Gene: ENSMUSG00000036731

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.2e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152997
Meta Mutation Damage Score 0.2000 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 14,055,605 (GRCm39) R571* probably null Het
Asb18 A T 1: 89,942,193 (GRCm39) I36N probably damaging Het
Ascc3 G A 10: 50,576,081 (GRCm39) G779S probably damaging Het
Atl2 T C 17: 80,161,984 (GRCm39) Q205R probably damaging Het
Axdnd1 A G 1: 156,220,315 (GRCm39) I235T probably damaging Het
Bri3bp A G 5: 125,531,765 (GRCm39) N237S probably damaging Het
Ccdc191 A G 16: 43,735,848 (GRCm39) N256S probably benign Het
Cchcr1 T C 17: 35,839,073 (GRCm39) I474T probably damaging Het
Cd209c T C 8: 3,994,984 (GRCm39) Y60C probably damaging Het
Cd300c C A 11: 114,848,381 (GRCm39) D171Y probably damaging Het
Crb1 C T 1: 139,165,200 (GRCm39) V975M probably damaging Het
Csmd1 C T 8: 17,585,020 (GRCm39) probably benign Het
Ctnna2 A G 6: 76,957,678 (GRCm39) S524P possibly damaging Het
Eno1 T C 4: 150,324,025 (GRCm39) probably null Het
Ero1a T C 14: 45,537,415 (GRCm39) I170M probably damaging Het
Fam186a A G 15: 99,845,212 (GRCm39) M344T unknown Het
Frem1 A T 4: 82,832,029 (GRCm39) probably null Het
Gjb5 G T 4: 127,249,723 (GRCm39) D140E possibly damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Hk2 G T 6: 82,713,734 (GRCm39) S449R probably damaging Het
Hs3st3a1 A T 11: 64,411,427 (GRCm39) I322F probably benign Het
Itga1 T C 13: 115,102,196 (GRCm39) I1145V probably damaging Het
Kcp A G 6: 29,484,693 (GRCm39) L1295S probably damaging Het
Macf1 T C 4: 123,304,355 (GRCm39) D49G possibly damaging Het
Mef2b T A 8: 70,618,209 (GRCm39) D96E probably benign Het
Megf10 A T 18: 57,394,259 (GRCm39) D461V probably benign Het
Myom1 T C 17: 71,408,071 (GRCm39) S1104P probably damaging Het
Nab1 A G 1: 52,529,381 (GRCm39) L172P probably damaging Het
Or2g1 T G 17: 38,106,387 (GRCm39) D17E probably benign Het
Pate1 A G 9: 35,598,324 (GRCm39) V18A probably benign Het
Pink1 T C 4: 138,048,045 (GRCm39) probably null Het
Pnpla1 T A 17: 29,097,455 (GRCm39) I207N probably damaging Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Ppp1r21 C A 17: 88,889,840 (GRCm39) probably null Het
Rad52 A G 6: 119,891,168 (GRCm39) E76G unknown Het
Rad54l A G 4: 115,968,386 (GRCm39) probably null Het
Rasgrf2 T C 13: 92,267,954 (GRCm39) M17V probably benign Het
Rbm42 A G 7: 30,340,738 (GRCm39) M411T unknown Het
Reln A G 5: 22,256,359 (GRCm39) I495T probably benign Het
Rrm1 C A 7: 102,095,909 (GRCm39) H87Q probably damaging Het
Sec14l2 T C 11: 4,053,962 (GRCm39) D235G possibly damaging Het
Serpinb3d G T 1: 107,008,483 (GRCm39) N127K probably benign Het
Skint7 A T 4: 111,837,490 (GRCm39) E89D probably benign Het
Slc22a5 T G 11: 53,782,196 (GRCm39) N57T probably damaging Het
Smarcd3 A T 5: 24,799,982 (GRCm39) F263I probably damaging Het
Sncaip A G 18: 53,001,676 (GRCm39) I66V probably damaging Het
Syngr1 A C 15: 79,999,791 (GRCm39) probably benign Het
Tbc1d2 A G 4: 46,614,420 (GRCm39) Y554H probably benign Het
Tmem198 T C 1: 75,456,387 (GRCm39) V44A probably benign Het
Trappc11 T C 8: 47,965,320 (GRCm39) probably null Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vmn2r111 C T 17: 22,767,583 (GRCm39) C638Y probably damaging Het
Washc4 A G 10: 83,410,308 (GRCm39) Y632C probably damaging Het
Zfp212 T C 6: 47,907,831 (GRCm39) V270A probably benign Het
Zfp92 G A X: 72,465,574 (GRCm39) R189H possibly damaging Homo
Other mutations in Rnf224
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Rnf224 APN 2 25,126,259 (GRCm39) missense possibly damaging 0.51
IGL02236:Rnf224 APN 2 25,126,260 (GRCm39) missense probably damaging 0.96
R0036:Rnf224 UTSW 2 25,126,143 (GRCm39) missense probably damaging 1.00
R0240:Rnf224 UTSW 2 25,126,219 (GRCm39) missense probably damaging 0.98
R0240:Rnf224 UTSW 2 25,126,219 (GRCm39) missense probably damaging 0.98
R1528:Rnf224 UTSW 2 25,126,110 (GRCm39) missense probably benign 0.04
R5739:Rnf224 UTSW 2 25,126,012 (GRCm39) missense probably benign
R9567:Rnf224 UTSW 2 25,126,354 (GRCm39) start gained probably benign
R9621:Rnf224 UTSW 2 25,126,200 (GRCm39) missense probably benign 0.09
R9674:Rnf224 UTSW 2 25,126,330 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGGAGAGTTGTCTTGCTAGC -3'
(R):5'- ACAACACTGGATCCCCTGTC -3'

Sequencing Primer
(F):5'- TCTTGCTAGCAGGCTGTTC -3'
(R):5'- TGCCGACAAAGTACCCCTGTG -3'
Posted On 2018-04-27