Incidental Mutation 'R6369:Rnf224'
ID512834
Institutional Source Beutler Lab
Gene Symbol Rnf224
Ensembl Gene ENSMUSG00000089953
Gene Namering finger protein 224
SynonymsGm757, LOC329360
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6369 (G1)
Quality Score223.009
Status Validated
Chromosome2
Chromosomal Location25234476-25236787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25235942 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 133 (F133S)
Ref Sequence ENSEMBL: ENSMUSP00000145127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000043379] [ENSMUST00000091318] [ENSMUST00000114356] [ENSMUST00000186719] [ENSMUST00000205192]
Predicted Effect probably benign
Transcript: ENSMUST00000006638
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043379
SMART Domains Protein: ENSMUSP00000045363
Gene: ENSMUSG00000036731

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.2e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091318
AA Change: F133S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088868
Gene: ENSMUSG00000089953
AA Change: F133S

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091318
AA Change: F133S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145470
Gene: ENSMUSG00000089953
AA Change: F133S

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114356
SMART Domains Protein: ENSMUSP00000109996
Gene: ENSMUSG00000036731

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.3e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155420
Predicted Effect probably benign
Transcript: ENSMUST00000186719
SMART Domains Protein: ENSMUSP00000140416
Gene: ENSMUSG00000036731

DomainStartEndE-ValueType
Pfam:DUF2477 1 141 2.2e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205192
AA Change: F133S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145127
Gene: ENSMUSG00000089953
AA Change: F133S

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Meta Mutation Damage Score 0.2000 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn C T 17: 13,835,343 R571* probably null Het
Asb18 A T 1: 90,014,471 I36N probably damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atl2 T C 17: 79,854,555 Q205R probably damaging Het
Axdnd1 A G 1: 156,392,745 I235T probably damaging Het
Bri3bp A G 5: 125,454,701 N237S probably damaging Het
Ccdc191 A G 16: 43,915,485 N256S probably benign Het
Cchcr1 T C 17: 35,528,176 I474T probably damaging Het
Cd209c T C 8: 3,944,984 Y60C probably damaging Het
Cd300c C A 11: 114,957,555 D171Y probably damaging Het
Crb1 C T 1: 139,237,462 V975M probably damaging Het
Csmd1 C T 8: 17,535,004 probably benign Het
Ctnna2 A G 6: 76,980,695 S524P possibly damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Ero1l T C 14: 45,299,958 I170M probably damaging Het
Fam186a A G 15: 99,947,331 M344T unknown Het
Frem1 A T 4: 82,913,792 probably null Het
Gjb5 G T 4: 127,355,930 D140E possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hk2 G T 6: 82,736,753 S449R probably damaging Het
Hs3st3a1 A T 11: 64,520,601 I322F probably benign Het
Itga1 T C 13: 114,965,660 I1145V probably damaging Het
Kcp A G 6: 29,484,694 L1295S probably damaging Het
Macf1 T C 4: 123,410,562 D49G possibly damaging Het
Mef2b T A 8: 70,165,559 D96E probably benign Het
Megf10 A T 18: 57,261,187 D461V probably benign Het
Myom1 T C 17: 71,101,076 S1104P probably damaging Het
Nab1 A G 1: 52,490,222 L172P probably damaging Het
Olfr123 T G 17: 37,795,496 D17E probably benign Het
Pate1 A G 9: 35,687,028 V18A probably benign Het
Pink1 T C 4: 138,320,734 probably null Het
Pnpla1 T A 17: 28,878,481 I207N probably damaging Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Ppp1r21 C A 17: 88,582,412 probably null Het
Rad52 A G 6: 119,914,207 E76G unknown Het
Rad54l A G 4: 116,111,189 probably null Het
Rasgrf2 T C 13: 92,131,446 M17V probably benign Het
Rbm42 A G 7: 30,641,313 M411T unknown Het
Reln A G 5: 22,051,361 I495T probably benign Het
Rrm1 C A 7: 102,446,702 H87Q probably damaging Het
Sec14l2 T C 11: 4,103,962 D235G possibly damaging Het
Serpinb3d G T 1: 107,080,753 N127K probably benign Het
Skint7 A T 4: 111,980,293 E89D probably benign Het
Slc22a5 T G 11: 53,891,370 N57T probably damaging Het
Smarcd3 A T 5: 24,594,984 F263I probably damaging Het
Sncaip A G 18: 52,868,604 I66V probably damaging Het
Syngr1 A C 15: 80,115,590 probably benign Het
Tbc1d2 A G 4: 46,614,420 Y554H probably benign Het
Tmem198 T C 1: 75,479,743 V44A probably benign Het
Trappc11 T C 8: 47,512,285 probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r111 C T 17: 22,548,602 C638Y probably damaging Het
Washc4 A G 10: 83,574,444 Y632C probably damaging Het
Zfp212 T C 6: 47,930,897 V270A probably benign Het
Zfp92 G A X: 73,421,968 R189H possibly damaging Homo
Other mutations in Rnf224
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Rnf224 APN 2 25236247 missense possibly damaging 0.51
IGL02236:Rnf224 APN 2 25236248 missense probably damaging 0.96
R0036:Rnf224 UTSW 2 25236131 missense probably damaging 1.00
R0240:Rnf224 UTSW 2 25236207 missense probably damaging 0.98
R0240:Rnf224 UTSW 2 25236207 missense probably damaging 0.98
R1528:Rnf224 UTSW 2 25236098 missense probably benign 0.04
R5739:Rnf224 UTSW 2 25236000 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGGAGAGTTGTCTTGCTAGC -3'
(R):5'- ACAACACTGGATCCCCTGTC -3'

Sequencing Primer
(F):5'- TCTTGCTAGCAGGCTGTTC -3'
(R):5'- TGCCGACAAAGTACCCCTGTG -3'
Posted On2018-04-27