Incidental Mutation 'R6386:Gje1'
ID515609
Institutional Source Beutler Lab
Gene Symbol Gje1
Ensembl Gene ENSMUSG00000019867
Gene Namegap junction protein, epsilon 1
SynonymsAEY12, connexin 23, Cx23, Gjf1, Gsfaey12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location14715623-14718214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14716621 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 139 (F139S)
Ref Sequence ENSEMBL: ENSMUSP00000020016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020016] [ENSMUST00000190114] [ENSMUST00000191238]
Predicted Effect probably damaging
Transcript: ENSMUST00000020016
AA Change: F139S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020016
Gene: ENSMUSG00000019867
AA Change: F139S

DomainStartEndE-ValueType
Blast:Connexin_CCC 31 74 3e-21 BLAST
Connexin_CCC 125 194 2.75e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188021
Predicted Effect probably benign
Transcript: ENSMUST00000190114
SMART Domains Protein: ENSMUSP00000140754
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 8 119 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191238
Meta Mutation Damage Score 0.1538 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with a mutation in this gene have small eyes. Eye/lens development arrests at the lens vesicle stage, and no primary lens fibers form. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Gje1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Gje1 APN 10 14716669 missense probably damaging 1.00
IGL02579:Gje1 APN 10 14716748 missense probably benign 0.23
IGL03046:Gje1 UTSW 10 14716630 missense probably damaging 1.00
R0884:Gje1 UTSW 10 14716740 missense possibly damaging 0.84
R1444:Gje1 UTSW 10 14716636 intron probably null
R1666:Gje1 UTSW 10 14716807 missense possibly damaging 0.57
R1725:Gje1 UTSW 10 14716424 nonsense probably null
R4841:Gje1 UTSW 10 14717338 missense probably null 1.00
R4842:Gje1 UTSW 10 14717338 missense probably null 1.00
R5048:Gje1 UTSW 10 14717277 missense probably damaging 1.00
R5104:Gje1 UTSW 10 14716718 nonsense probably null
R5421:Gje1 UTSW 10 14716684 missense probably damaging 1.00
R5422:Gje1 UTSW 10 14716684 missense probably damaging 1.00
R5897:Gje1 UTSW 10 14716723 missense probably damaging 1.00
R6930:Gje1 UTSW 10 14718142 missense possibly damaging 0.90
R7426:Gje1 UTSW 10 14716479 missense probably damaging 1.00
R7576:Gje1 UTSW 10 14716757 missense probably damaging 1.00
R7650:Gje1 UTSW 10 14716424 nonsense probably null
R8020:Gje1 UTSW 10 14717277 missense probably damaging 1.00
X0065:Gje1 UTSW 10 14716599 missense possibly damaging 0.82
Z1088:Gje1 UTSW 10 14718124 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CAACCCGGTCATCGTTTAAAGAG -3'
(R):5'- TCTGGGCATTGCAGCTAGTG -3'

Sequencing Primer
(F):5'- CCGGTCATCGTTTAAAGAGAAAAC -3'
(R):5'- CATTGCAGCTAGTGATTGTCC -3'
Posted On2018-05-04