Incidental Mutation 'R6544:Olfr1111'
ID520992
Institutional Source Beutler Lab
Gene Symbol Olfr1111
Ensembl Gene ENSMUSG00000075158
Gene Nameolfactory receptor 1111
SynonymsMOR181-2, GA_x6K02T2Q125-48635468-48634530
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87149181-87152624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87149863 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 266 (Y266F)
Ref Sequence ENSEMBL: ENSMUSP00000150760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099860] [ENSMUST00000214492] [ENSMUST00000216378]
Predicted Effect probably damaging
Transcript: ENSMUST00000099860
AA Change: Y266F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097446
Gene: ENSMUSG00000075158
AA Change: Y266F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-54 PFAM
Pfam:7tm_1 41 290 7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214492
AA Change: Y266F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216378
AA Change: Y266F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Olfr1111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Olfr1111 APN 2 87149825 missense possibly damaging 0.53
IGL02217:Olfr1111 APN 2 87149887 missense probably benign 0.00
R0789:Olfr1111 UTSW 2 87149827 missense probably damaging 1.00
R1437:Olfr1111 UTSW 2 87149771 missense possibly damaging 0.94
R1696:Olfr1111 UTSW 2 87150380 missense probably benign 0.00
R1700:Olfr1111 UTSW 2 87149779 missense probably damaging 1.00
R1717:Olfr1111 UTSW 2 87149806 nonsense probably null
R4965:Olfr1111 UTSW 2 87150659 start codon destroyed possibly damaging 0.89
R5221:Olfr1111 UTSW 2 87150481 missense probably damaging 1.00
R5297:Olfr1111 UTSW 2 87150449 missense probably benign 0.01
R5837:Olfr1111 UTSW 2 87150355 missense probably benign 0.02
R6911:Olfr1111 UTSW 2 87149767 missense probably damaging 1.00
R8537:Olfr1111 UTSW 2 87150038 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAACATATATCTTTAAAGCCAGCCAGG -3'
(R):5'- CTTTGCTTTATGTGGTACAATCCAGAC -3'

Sequencing Primer
(F):5'- TCTTTAAAGCCAGCCAGGAATTAAC -3'
(R):5'- AGACCAGCACTTTCATGGTC -3'
Posted On2018-06-06