Incidental Mutation 'R6544:Pip5k1c'
ID 521031
Institutional Source Beutler Lab
Gene Symbol Pip5k1c
Ensembl Gene ENSMUSG00000034902
Gene Name phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms PIP5KIgamma
MMRRC Submission 044670-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6544 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 81128797-81155807 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81144830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 224 (Y224N)
Ref Sequence ENSEMBL: ENSMUSP00000124155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000163075] [ENSMUST00000161869] [ENSMUST00000161854]
AlphaFold O70161
Predicted Effect probably damaging
Transcript: ENSMUST00000045469
AA Change: Y224N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: Y224N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105327
AA Change: Y224N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: Y224N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159895
Predicted Effect probably benign
Transcript: ENSMUST00000160291
SMART Domains Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161586
SMART Domains Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 54 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161719
SMART Domains Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
Pfam:PIP5K 1 133 1.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163075
AA Change: Y224N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: Y224N

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161869
SMART Domains Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,036,678 (GRCm39) K118* probably null Het
Actr2 A G 11: 20,050,933 (GRCm39) F17L probably damaging Het
Adam26b T C 8: 43,974,818 (GRCm39) I61M probably damaging Het
Ahcyl A C 16: 45,975,147 (GRCm39) S77A probably benign Het
Ahnak2 A G 12: 112,746,829 (GRCm39) probably benign Het
Angptl3 T C 4: 98,919,675 (GRCm39) L145P probably damaging Het
Ank2 T C 3: 126,726,871 (GRCm39) T808A probably damaging Het
Ark2c T A 18: 77,650,931 (GRCm39) probably benign Het
Cadm3 A G 1: 173,194,977 (GRCm39) probably null Het
Cog7 C T 7: 121,534,966 (GRCm39) R573Q probably damaging Het
Dchs1 T A 7: 105,407,385 (GRCm39) I2110F probably damaging Het
Fbxo47 G A 11: 97,747,089 (GRCm39) R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 (GRCm39) D583V probably damaging Het
Gigyf1 T A 5: 137,523,321 (GRCm39) L911Q probably damaging Het
Gprin1 G A 13: 54,888,124 (GRCm39) A50V possibly damaging Het
Grik4 A T 9: 42,459,024 (GRCm39) Y571* probably null Het
Gucy2e A G 11: 69,126,483 (GRCm39) V299A probably benign Het
Hectd2 C T 19: 36,589,728 (GRCm39) L618F probably damaging Het
Lactbl1 A T 4: 136,360,300 (GRCm39) I160F possibly damaging Het
Lats1 T A 10: 7,577,434 (GRCm39) V186D possibly damaging Het
Lmtk2 A G 5: 144,110,624 (GRCm39) H448R possibly damaging Het
Map10 T C 8: 126,398,113 (GRCm39) I502T probably benign Het
Mok A G 12: 110,777,189 (GRCm39) F239S probably damaging Het
Mprip G A 11: 59,648,552 (GRCm39) G752D probably benign Het
Naip5 C A 13: 100,359,652 (GRCm39) G528V possibly damaging Het
Neu2 T C 1: 87,524,464 (GRCm39) W150R probably damaging Het
Or1ak2 T A 2: 36,827,539 (GRCm39) M136K possibly damaging Het
Or5an1 T C 19: 12,260,519 (GRCm39) Y36H probably damaging Het
Or5as1 T A 2: 86,980,207 (GRCm39) Y266F probably damaging Het
Or5l13 T A 2: 87,780,335 (GRCm39) M81L probably benign Het
Plch1 T C 3: 63,758,399 (GRCm39) E5G probably damaging Het
Pspc1 T C 14: 57,001,660 (GRCm39) *59W probably null Het
Ptprq T C 10: 107,444,102 (GRCm39) T1501A probably damaging Het
Rorb G T 19: 18,929,614 (GRCm39) P304T possibly damaging Het
Scn7a A T 2: 66,514,444 (GRCm39) L1110Q probably damaging Het
Serpine2 C T 1: 79,780,847 (GRCm39) probably null Het
Slco1c1 A G 6: 141,477,170 (GRCm39) probably null Het
Smarca2 T A 19: 26,608,331 (GRCm39) V130D probably damaging Het
Sox17 G T 1: 4,562,655 (GRCm39) P117T possibly damaging Het
Sparcl1 A T 5: 104,240,310 (GRCm39) Y371* probably null Het
Tdpoz2 T C 3: 93,559,267 (GRCm39) D235G possibly damaging Het
Tns2 A C 15: 102,022,269 (GRCm39) K1182N possibly damaging Het
Tpte G T 8: 22,805,121 (GRCm39) probably null Het
Ttn A T 2: 76,799,503 (GRCm39) I459K possibly damaging Het
Wdr97 T C 15: 76,242,478 (GRCm39) Y823H probably benign Het
Zc3h15 G A 2: 83,491,492 (GRCm39) R240H probably benign Het
Zfp455 C A 13: 67,355,121 (GRCm39) L130I probably benign Het
Zfp777 A T 6: 48,021,419 (GRCm39) S68T probably damaging Het
Other mutations in Pip5k1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pip5k1c APN 10 81,141,545 (GRCm39) missense probably benign 0.45
IGL02274:Pip5k1c APN 10 81,142,218 (GRCm39) missense probably damaging 1.00
IGL02500:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02565:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02577:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02579:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02581:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02604:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02610:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02613:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02616:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02617:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02639:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02641:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02642:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
IGL02724:Pip5k1c APN 10 81,149,296 (GRCm39) missense probably benign 0.01
IGL02751:Pip5k1c APN 10 81,153,155 (GRCm39) splice site probably null
PIT4366001:Pip5k1c UTSW 10 81,144,842 (GRCm39) missense probably damaging 0.98
R0257:Pip5k1c UTSW 10 81,150,930 (GRCm39) missense possibly damaging 0.86
R1643:Pip5k1c UTSW 10 81,150,828 (GRCm39) missense probably damaging 1.00
R1663:Pip5k1c UTSW 10 81,148,349 (GRCm39) missense probably damaging 1.00
R1872:Pip5k1c UTSW 10 81,142,153 (GRCm39) missense probably damaging 0.99
R2293:Pip5k1c UTSW 10 81,149,918 (GRCm39) missense possibly damaging 0.82
R2295:Pip5k1c UTSW 10 81,141,020 (GRCm39) missense probably benign 0.40
R2310:Pip5k1c UTSW 10 81,142,142 (GRCm39) missense probably damaging 0.96
R2406:Pip5k1c UTSW 10 81,144,858 (GRCm39) missense probably damaging 1.00
R4504:Pip5k1c UTSW 10 81,150,945 (GRCm39) missense probably damaging 0.98
R4772:Pip5k1c UTSW 10 81,151,774 (GRCm39) missense probably benign
R5022:Pip5k1c UTSW 10 81,146,723 (GRCm39) splice site probably null
R5023:Pip5k1c UTSW 10 81,146,723 (GRCm39) splice site probably null
R5033:Pip5k1c UTSW 10 81,141,084 (GRCm39) missense probably damaging 0.99
R5057:Pip5k1c UTSW 10 81,146,723 (GRCm39) splice site probably null
R5482:Pip5k1c UTSW 10 81,128,897 (GRCm39) missense probably damaging 0.98
R6305:Pip5k1c UTSW 10 81,151,768 (GRCm39) missense probably benign 0.02
R6511:Pip5k1c UTSW 10 81,146,651 (GRCm39) missense probably damaging 1.00
R7512:Pip5k1c UTSW 10 81,150,953 (GRCm39) critical splice donor site probably null
R7581:Pip5k1c UTSW 10 81,144,794 (GRCm39) missense probably damaging 1.00
R8218:Pip5k1c UTSW 10 81,142,250 (GRCm39) missense probably damaging 1.00
R8686:Pip5k1c UTSW 10 81,147,827 (GRCm39) missense probably damaging 0.99
R8927:Pip5k1c UTSW 10 81,128,906 (GRCm39) missense possibly damaging 0.95
R8928:Pip5k1c UTSW 10 81,128,906 (GRCm39) missense possibly damaging 0.95
R9048:Pip5k1c UTSW 10 81,152,710 (GRCm39) intron probably benign
R9049:Pip5k1c UTSW 10 81,152,710 (GRCm39) intron probably benign
R9100:Pip5k1c UTSW 10 81,145,056 (GRCm39) missense probably benign 0.01
R9443:Pip5k1c UTSW 10 81,153,184 (GRCm39) missense probably damaging 0.99
R9448:Pip5k1c UTSW 10 81,141,645 (GRCm39) missense probably damaging 1.00
R9466:Pip5k1c UTSW 10 81,152,710 (GRCm39) intron probably benign
R9775:Pip5k1c UTSW 10 81,147,853 (GRCm39) missense probably damaging 0.98
R9780:Pip5k1c UTSW 10 81,141,030 (GRCm39) missense probably benign 0.01
Z1177:Pip5k1c UTSW 10 81,150,866 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TAGGCAGTTAGGAAGTCACCC -3'
(R):5'- TTCTGAGCACACATGGCAGC -3'

Sequencing Primer
(F):5'- TGTACGATGGCTCCTTGT -3'
(R):5'- ATGTCCTGCATGAAGTCCAG -3'
Posted On 2018-06-06