Incidental Mutation 'R6544:Rorb'
ID521064
Institutional Source Beutler Lab
Gene Symbol Rorb
Ensembl Gene ENSMUSG00000036192
Gene NameRAR-related orphan receptor beta
SynonymsNr1f2, Rorbeta, RZR-beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location18930605-19111196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18952250 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 304 (P304T)
Ref Sequence ENSEMBL: ENSMUSP00000108447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040153] [ENSMUST00000112828] [ENSMUST00000112832]
Predicted Effect probably benign
Transcript: ENSMUST00000040153
AA Change: P389T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047597
Gene: ENSMUSG00000036192
AA Change: P389T

DomainStartEndE-ValueType
ZnF_C4 18 89 1.51e-39 SMART
coiled coil region 95 133 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HOLI 275 431 1.83e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112828
AA Change: P304T

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108447
Gene: ENSMUSG00000036192
AA Change: P304T

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
HOLI 190 346 1.83e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112832
AA Change: P378T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108451
Gene: ENSMUSG00000036192
AA Change: P378T

DomainStartEndE-ValueType
ZnF_C4 7 78 1.51e-39 SMART
coiled coil region 84 122 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HOLI 264 420 1.83e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Rorb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18957328 nonsense probably null
IGL01576:Rorb APN 19 18957334 missense probably damaging 1.00
IGL02863:Rorb APN 19 18952253 missense probably benign 0.05
IGL02886:Rorb APN 19 18977579 critical splice donor site probably null
4-limb_clasper UTSW 19 18983351 missense probably damaging 1.00
dee-no UTSW 19 18955053 missense probably damaging 1.00
grasshopper UTSW 19 19110557 start codon destroyed probably null 0.45
IGL02988:Rorb UTSW 19 18937972 missense probably damaging 1.00
R0748:Rorb UTSW 19 18977800 missense probably damaging 0.97
R1087:Rorb UTSW 19 18960414 missense probably damaging 1.00
R1438:Rorb UTSW 19 18955053 missense probably damaging 1.00
R1710:Rorb UTSW 19 18960501 missense probably damaging 1.00
R1846:Rorb UTSW 19 18955081 missense probably damaging 1.00
R1852:Rorb UTSW 19 18962083 missense probably damaging 1.00
R1972:Rorb UTSW 19 18952203 missense probably damaging 0.96
R3903:Rorb UTSW 19 18962099 missense probably damaging 0.99
R3978:Rorb UTSW 19 18937890 missense probably benign 0.00
R4497:Rorb UTSW 19 18977628 missense possibly damaging 0.95
R4982:Rorb UTSW 19 18977688 missense probably benign 0.05
R5602:Rorb UTSW 19 18977937 missense probably damaging 0.97
R5733:Rorb UTSW 19 18988107 missense probably damaging 1.00
R6267:Rorb UTSW 19 18977857 missense possibly damaging 0.88
R6455:Rorb UTSW 19 18960492 missense probably damaging 1.00
R6753:Rorb UTSW 19 18957247 missense probably benign 0.02
R7817:Rorb UTSW 19 18988096 missense probably damaging 1.00
R8708:Rorb UTSW 19 18983416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATGCTGCTGAGACATTCAC -3'
(R):5'- ACCAAATGGCTTCTCTGTATCC -3'

Sequencing Primer
(F):5'- GAGACATTCACCCTGTTCATGCAG -3'
(R):5'- GTCAGCCTCACCTCACTATTTACAAG -3'
Posted On2018-06-06