Incidental Mutation 'R6560:Pcgf3'
ID522000
Institutional Source Beutler Lab
Gene Symbol Pcgf3
Ensembl Gene ENSMUSG00000033623
Gene Namepolycomb group ring finger 3
SynonymsRNF3A, Rnf3, D630042K08Rik, 2310035N15Rik, DONG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R6560 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location108461232-108506976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108473902 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 35 (H35Q)
Ref Sequence ENSEMBL: ENSMUSP00000108216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046975] [ENSMUST00000112597] [ENSMUST00000138264]
Predicted Effect probably damaging
Transcript: ENSMUST00000046975
AA Change: H35Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041790
Gene: ENSMUSG00000033623
AA Change: H35Q

DomainStartEndE-ValueType
RING 17 55 2.87e-5 SMART
Pfam:RAWUL 158 235 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112597
AA Change: H35Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108216
Gene: ENSMUSG00000033623
AA Change: H35Q

DomainStartEndE-ValueType
RING 17 55 2.87e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138264
AA Change: H35Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142465
Gene: ENSMUSG00000033623
AA Change: H35Q

DomainStartEndE-ValueType
PDB:2CKL|A 3 37 7e-9 PDB
SCOP:d1jm7b_ 5 37 4e-3 SMART
Blast:RING 17 37 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143973
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C3HC4 type RING finger, which is a motif known to be involved in protein-protein interactions. The specific function of this protein has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit limb defects and spleen agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,007,396 L1235Q probably damaging Het
Acin1 T C 14: 54,678,833 T174A probably benign Het
Adamtsl1 G A 4: 86,336,893 R733H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arsk A T 13: 76,074,986 I164N probably benign Het
Bbs5 T A 2: 69,656,956 N194K probably damaging Het
Bicra T C 7: 15,989,194 T133A possibly damaging Het
Card6 G A 15: 5,098,885 P1010S probably damaging Het
Ccdc18 T A 5: 108,191,924 N778K probably benign Het
Cept1 T C 3: 106,505,278 I240V possibly damaging Het
Crip3 A G 17: 46,431,036 R150G probably damaging Het
Cyp2c50 A G 19: 40,096,855 T320A probably benign Het
Dio2 G C 12: 90,729,833 S127* probably null Het
Dscam T C 16: 96,825,735 S325G probably benign Het
Exosc4 A G 15: 76,327,613 I41V probably benign Het
Glb1l3 C T 9: 26,828,424 probably null Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm3072 T A 14: 41,623,553 D89V unknown Het
Gosr2 T C 11: 103,686,682 H79R probably damaging Het
Has2 T A 15: 56,668,264 T352S probably damaging Het
Insig1 T A 5: 28,071,533 C32* probably null Het
Klf9 A G 19: 23,141,950 S66G probably damaging Het
Mfn1 T C 3: 32,569,516 I263T probably damaging Het
Myl2 G A 5: 122,102,771 G38R probably null Het
Negr1 A G 3: 157,312,857 T332A probably benign Het
Neo1 A G 9: 58,880,601 S1417P possibly damaging Het
Olfr599 T C 7: 103,338,738 F228S probably benign Het
Olfr859 G A 9: 19,809,116 S266N probably benign Het
Plppr5 A G 3: 117,671,990 I297V probably benign Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Prx A T 7: 27,515,321 Q85H probably damaging Het
Tex14 T G 11: 87,497,862 M305R possibly damaging Het
Wdr63 T C 3: 146,095,406 E99G possibly damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Zfp619 G A 7: 39,537,530 E995K probably damaging Het
Zfp90 A G 8: 106,415,747 R4G probably damaging Het
Other mutations in Pcgf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Pcgf3 APN 5 108486179 missense probably benign 0.18
R0501:Pcgf3 UTSW 5 108475112 missense probably damaging 1.00
R1192:Pcgf3 UTSW 5 108486188 missense probably benign
R4947:Pcgf3 UTSW 5 108487961 missense probably benign 0.03
R8087:Pcgf3 UTSW 5 108486236 missense probably benign
R8152:Pcgf3 UTSW 5 108487857 missense probably benign
R8398:Pcgf3 UTSW 5 108499643 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGTGGGTGGAGTAAAGGCA -3'
(R):5'- GAAACCACCCTCCAGAAGTT -3'

Sequencing Primer
(F):5'- AGAGTTCTATCTCAGCCACTTGGG -3'
(R):5'- GTTACCCACAACATCCCTAGTTATGG -3'
Posted On2018-06-06