Incidental Mutation 'R7807:Cdh13'
ID600865
Institutional Source Beutler Lab
Gene Symbol Cdh13
Ensembl Gene ENSMUSG00000031841
Gene Namecadherin 13
SynonymsT-cadherin, 4932416G01Rik, Tcad
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7807 (G1)
Quality Score201.009
Status Validated
Chromosome8
Chromosomal Location118283733-119324921 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 118283855 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000113527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117160]
PDB Structure Crystal Structure of mouse T-cadherin EC1 EC2 [X-RAY DIFFRACTION]
Crystal structure of mouse T-cadherin EC1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000117160
AA Change: M1K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113527
Gene: ENSMUSG00000031841
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Cadherin_pro 26 112 1.04e-17 SMART
CA 160 243 1.49e-18 SMART
CA 267 361 1.84e-23 SMART
CA 383 476 8.75e-16 SMART
CA 499 583 2.36e-21 SMART
CA 604 687 5.93e-2 SMART
low complexity region 695 714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is highly expressed in the vasculature including endothelial cells, smooth muscle cells and pericytes, where the encoded protein binds to adiponectin and has been implicated in the modulation of angiogenesis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased retinal neovascularization and increased adiponectin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik T C 2: 130,710,865 K1092E probably damaging Het
AB124611 C A 9: 21,535,980 T146K probably benign Het
Alms1 T A 6: 85,622,976 S1595T possibly damaging Het
Ankrd44 A T 1: 54,792,476 I56N probably damaging Het
Anln C A 9: 22,360,880 V648F probably damaging Het
Arhgap29 A G 3: 122,014,332 D1053G probably benign Het
Baalc T C 15: 38,934,017 S68P probably benign Het
Begain T C 12: 109,038,930 D52G probably damaging Het
Blmh A G 11: 76,946,214 I41V probably benign Het
Bpifc T A 10: 85,976,250 I365F possibly damaging Het
C2 G T 17: 34,876,371 S199R possibly damaging Het
Ccbe1 T A 18: 66,066,757 H298L probably damaging Het
Ccdc112 T A 18: 46,290,759 K304I probably damaging Het
Ccdc15 T C 9: 37,315,382 E432G probably benign Het
Cipc T C 12: 86,962,125 S253P possibly damaging Het
Clcn1 A G 6: 42,310,348 probably null Het
Clock A T 5: 76,243,135 N273K probably benign Het
Cyp19a1 T C 9: 54,166,842 D476G probably benign Het
Dnah7b A G 1: 46,214,367 I1811V probably benign Het
Fat1 C A 8: 45,041,973 T4091K probably damaging Het
Gm10340 T A 14: 3,134,925 N64K probably damaging Het
Gm12394 A C 4: 42,793,885 H82Q probably benign Het
Hectd1 G A 12: 51,745,388 R2523C probably damaging Het
Hgf A G 5: 16,577,011 H244R probably damaging Het
Hgs G T 11: 120,479,934 A567S probably damaging Het
Igdcc4 T C 9: 65,133,795 V1036A probably benign Het
Keg1 G A 19: 12,714,634 probably null Het
Klhl8 A T 5: 103,876,066 L156Q probably damaging Het
Lmln T C 16: 33,107,131 Y521H probably benign Het
Lrrc7 A G 3: 158,160,487 S1206P probably damaging Het
Mad1l1 T A 5: 140,088,786 I550F probably benign Het
Marf1 C T 16: 14,153,889 W28* probably null Het
Mfsd11 T G 11: 116,863,907 S215A probably benign Het
Mpped2 C A 2: 106,744,740 H57N possibly damaging Het
Mslnl A G 17: 25,746,777 M542V probably benign Het
Myh6 G T 14: 54,942,440 H1903Q probably damaging Het
Neo1 T C 9: 58,990,494 T60A probably benign Het
Npm2 T A 14: 70,652,507 probably null Het
Olfr1165-ps T C 2: 88,101,565 S141G probably benign Het
Olfr1355 T A 10: 78,879,209 S12R probably benign Het
Olfr1487 C A 19: 13,619,921 T210K probably damaging Het
Pax9 A T 12: 56,697,065 I166F possibly damaging Het
Pcsk9 A G 4: 106,463,895 S6P possibly damaging Het
Pikfyve A G 1: 65,269,942 Y1893C probably damaging Het
Pirb T C 7: 3,719,865 T43A possibly damaging Het
Pou3f1 A G 4: 124,658,281 D192G possibly damaging Het
Pus3 C G 9: 35,566,725 R418G probably damaging Het
Rexo1 C T 10: 80,550,136 V363I probably benign Het
Sdcbp A G 4: 6,393,688 T269A probably damaging Het
Sele T C 1: 164,053,893 V523A probably benign Het
Serpinb8 T A 1: 107,604,727 M183K probably damaging Het
Sh2d4a T G 8: 68,282,381 S51A probably benign Het
Siglec15 A G 18: 78,047,481 S201P probably damaging Het
Slc10a5 C T 3: 10,335,469 V44I probably benign Het
Slc16a13 A G 11: 70,220,562 V39A probably damaging Het
Slc25a13 G A 6: 6,117,164 R184W probably damaging Het
Slc35f5 T A 1: 125,584,541 D359E probably damaging Het
Slc3a1 A G 17: 85,063,943 E641G probably benign Het
Slf1 T C 13: 77,046,704 D834G probably damaging Het
Stim1 T C 7: 102,427,141 I433T probably damaging Het
Stra6 T A 9: 58,150,161 I418K probably damaging Het
Tanc2 A G 11: 105,867,654 N747S probably benign Het
Tet2 T C 3: 133,486,541 T711A possibly damaging Het
Trpm6 T C 19: 18,829,856 I988T probably benign Het
Ttc41 T A 10: 86,776,631 I1256N probably benign Het
Uba2 T C 7: 34,163,213 D100G possibly damaging Het
Vmn1r43 A G 6: 89,870,237 I89T probably benign Het
Vmn2r58 T A 7: 41,872,486 Y62F probably benign Het
Ylpm1 C T 12: 85,014,081 Q428* probably null Het
Zcrb1 T C 15: 93,391,121 D88G probably damaging Het
Zmym1 A C 4: 127,047,874 I907S probably damaging Het
Other mutations in Cdh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdh13 APN 8 119312506 missense possibly damaging 0.87
IGL00659:Cdh13 APN 8 119312667 missense probably damaging 1.00
IGL01662:Cdh13 APN 8 118675177 missense probably damaging 0.99
IGL01719:Cdh13 APN 8 118675188 missense probably benign 0.01
IGL02148:Cdh13 APN 8 119198958 missense probably damaging 1.00
IGL02157:Cdh13 APN 8 118505671 missense possibly damaging 0.68
IGL02188:Cdh13 APN 8 118851761 missense probably benign 0.08
IGL02490:Cdh13 APN 8 119095323 missense probably damaging 1.00
IGL02851:Cdh13 APN 8 118675158 missense probably benign 0.32
IGL02958:Cdh13 APN 8 119312721 missense possibly damaging 0.90
IGL03085:Cdh13 APN 8 119288724 missense probably damaging 1.00
IGL03230:Cdh13 APN 8 119242317 missense probably damaging 1.00
IGL03280:Cdh13 APN 8 119314134 missense probably damaging 1.00
K3955:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
P0038:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
R0398:Cdh13 UTSW 8 119314047 missense probably damaging 1.00
R2156:Cdh13 UTSW 8 119236964 missense probably damaging 1.00
R3415:Cdh13 UTSW 8 118675207 missense probably benign 0.35
R4243:Cdh13 UTSW 8 119242257 missense probably damaging 1.00
R4839:Cdh13 UTSW 8 118851848 nonsense probably null
R4851:Cdh13 UTSW 8 118757390 missense possibly damaging 0.75
R5129:Cdh13 UTSW 8 119095215 missense probably damaging 1.00
R5453:Cdh13 UTSW 8 119198967 missense probably damaging 1.00
R5607:Cdh13 UTSW 8 118757474 missense probably benign
R5608:Cdh13 UTSW 8 118757474 missense probably benign
R5610:Cdh13 UTSW 8 118851723 missense possibly damaging 0.95
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6556:Cdh13 UTSW 8 118968187 missense probably damaging 0.99
R7124:Cdh13 UTSW 8 118968173 missense probably damaging 1.00
R7349:Cdh13 UTSW 8 119242358 missense probably damaging 0.97
R7418:Cdh13 UTSW 8 119312525 missense probably damaging 1.00
R7679:Cdh13 UTSW 8 119236919 missense probably benign 0.29
R8777:Cdh13 UTSW 8 119236967 critical splice donor site probably null
R8777-TAIL:Cdh13 UTSW 8 119236967 critical splice donor site probably null
X0025:Cdh13 UTSW 8 118505679 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGAAGGAATCCGTCTTGTAAAGCC -3'
(R):5'- TGACCTCGCATCTGAGCTAG -3'

Sequencing Primer
(F):5'- TAAAGCCATTGGTCCTGGTCATCAG -3'
(R):5'- CATCTGAGCTAGCCGGGTATATC -3'
Posted On2019-11-26