Mutagenetix > Incidental Mutations

Incidental Mutation 'R7807:Cdh13'

600865

Institutional Source

Beutler Lab

Gene Symbol

Cdh13

Ensembl Gene

ENSMUSG00000031841

Gene Name

cadherin 13

Synonyms

T-cadherin, 4932416G01Rik, Tcad

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7807 (G1)

Quality Score

201.009

Status

Validated

Chromosome

Chromosomal Location

118283733-119324921 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 118283855 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000113527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117160]

PDB Structure

Crystal Structure of mouse T-cadherin EC1 EC2 [X-RAY DIFFRACTION]
Crystal structure of mouse T-cadherin EC1 [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000117160
AA Change: M1K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113527
Gene: ENSMUSG00000031841
AA Change: M1K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Cadherin_pro	26	112	1.04e-17	SMART
CA	160	243	1.49e-18	SMART
CA	267	361	1.84e-23	SMART
CA	383	476	8.75e-16	SMART
CA	499	583	2.36e-21	SMART
CA	604	687	5.93e-2	SMART
low complexity region	695	714	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is highly expressed in the vasculature including endothelial cells, smooth muscle cells and pericytes, where the encoded protein binds to adiponectin and has been implicated in the modulation of angiogenesis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased retinal neovascularization and increased adiponectin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	T	C	2: 130,710,865	K1092E	probably damaging	Het
AB124611	C	A	9: 21,535,980	T146K	probably benign	Het
Alms1	T	A	6: 85,622,976	S1595T	possibly damaging	Het
Ankrd44	A	T	1: 54,792,476	I56N	probably damaging	Het
Anln	C	A	9: 22,360,880	V648F	probably damaging	Het
Arhgap29	A	G	3: 122,014,332	D1053G	probably benign	Het
Baalc	T	C	15: 38,934,017	S68P	probably benign	Het
Begain	T	C	12: 109,038,930	D52G	probably damaging	Het
Blmh	A	G	11: 76,946,214	I41V	probably benign	Het
Bpifc	T	A	10: 85,976,250	I365F	possibly damaging	Het
C2	G	T	17: 34,876,371	S199R	possibly damaging	Het
Ccbe1	T	A	18: 66,066,757	H298L	probably damaging	Het
Ccdc112	T	A	18: 46,290,759	K304I	probably damaging	Het
Ccdc15	T	C	9: 37,315,382	E432G	probably benign	Het
Cipc	T	C	12: 86,962,125	S253P	possibly damaging	Het
Clcn1	A	G	6: 42,310,348		probably null	Het
Clock	A	T	5: 76,243,135	N273K	probably benign	Het
Cyp19a1	T	C	9: 54,166,842	D476G	probably benign	Het
Dnah7b	A	G	1: 46,214,367	I1811V	probably benign	Het
Fat1	C	A	8: 45,041,973	T4091K	probably damaging	Het
Gm10340	T	A	14: 3,134,925	N64K	probably damaging	Het
Gm12394	A	C	4: 42,793,885	H82Q	probably benign	Het
Hectd1	G	A	12: 51,745,388	R2523C	probably damaging	Het
Hgf	A	G	5: 16,577,011	H244R	probably damaging	Het
Hgs	G	T	11: 120,479,934	A567S	probably damaging	Het
Igdcc4	T	C	9: 65,133,795	V1036A	probably benign	Het
Keg1	G	A	19: 12,714,634		probably null	Het
Klhl8	A	T	5: 103,876,066	L156Q	probably damaging	Het
Lmln	T	C	16: 33,107,131	Y521H	probably benign	Het
Lrrc7	A	G	3: 158,160,487	S1206P	probably damaging	Het
Mad1l1	T	A	5: 140,088,786	I550F	probably benign	Het
Marf1	C	T	16: 14,153,889	W28*	probably null	Het
Mfsd11	T	G	11: 116,863,907	S215A	probably benign	Het
Mpped2	C	A	2: 106,744,740	H57N	possibly damaging	Het
Mslnl	A	G	17: 25,746,777	M542V	probably benign	Het
Myh6	G	T	14: 54,942,440	H1903Q	probably damaging	Het
Neo1	T	C	9: 58,990,494	T60A	probably benign	Het
Npm2	T	A	14: 70,652,507		probably null	Het
Olfr1165-ps	T	C	2: 88,101,565	S141G	probably benign	Het
Olfr1355	T	A	10: 78,879,209	S12R	probably benign	Het
Olfr1487	C	A	19: 13,619,921	T210K	probably damaging	Het
Pax9	A	T	12: 56,697,065	I166F	possibly damaging	Het
Pcsk9	A	G	4: 106,463,895	S6P	possibly damaging	Het
Pikfyve	A	G	1: 65,269,942	Y1893C	probably damaging	Het
Pirb	T	C	7: 3,719,865	T43A	possibly damaging	Het
Pou3f1	A	G	4: 124,658,281	D192G	possibly damaging	Het
Pus3	C	G	9: 35,566,725	R418G	probably damaging	Het
Rexo1	C	T	10: 80,550,136	V363I	probably benign	Het
Sdcbp	A	G	4: 6,393,688	T269A	probably damaging	Het
Sele	T	C	1: 164,053,893	V523A	probably benign	Het
Serpinb8	T	A	1: 107,604,727	M183K	probably damaging	Het
Sh2d4a	T	G	8: 68,282,381	S51A	probably benign	Het
Siglec15	A	G	18: 78,047,481	S201P	probably damaging	Het
Slc10a5	C	T	3: 10,335,469	V44I	probably benign	Het
Slc16a13	A	G	11: 70,220,562	V39A	probably damaging	Het
Slc25a13	G	A	6: 6,117,164	R184W	probably damaging	Het
Slc35f5	T	A	1: 125,584,541	D359E	probably damaging	Het
Slc3a1	A	G	17: 85,063,943	E641G	probably benign	Het
Slf1	T	C	13: 77,046,704	D834G	probably damaging	Het
Stim1	T	C	7: 102,427,141	I433T	probably damaging	Het
Stra6	T	A	9: 58,150,161	I418K	probably damaging	Het
Tanc2	A	G	11: 105,867,654	N747S	probably benign	Het
Tet2	T	C	3: 133,486,541	T711A	possibly damaging	Het
Trpm6	T	C	19: 18,829,856	I988T	probably benign	Het
Ttc41	T	A	10: 86,776,631	I1256N	probably benign	Het
Uba2	T	C	7: 34,163,213	D100G	possibly damaging	Het
Vmn1r43	A	G	6: 89,870,237	I89T	probably benign	Het
Vmn2r58	T	A	7: 41,872,486	Y62F	probably benign	Het
Ylpm1	C	T	12: 85,014,081	Q428*	probably null	Het
Zcrb1	T	C	15: 93,391,121	D88G	probably damaging	Het
Zmym1	A	C	4: 127,047,874	I907S	probably damaging	Het

Other mutations in Cdh13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Cdh13	APN	8	119312506	missense	possibly damaging	0.87
IGL00659:Cdh13	APN	8	119312667	missense	probably damaging	1.00
IGL01662:Cdh13	APN	8	118675177	missense	probably damaging	0.99
IGL01719:Cdh13	APN	8	118675188	missense	probably benign	0.01
IGL02148:Cdh13	APN	8	119198958	missense	probably damaging	1.00
IGL02157:Cdh13	APN	8	118505671	missense	possibly damaging	0.68
IGL02188:Cdh13	APN	8	118851761	missense	probably benign	0.08
IGL02490:Cdh13	APN	8	119095323	missense	probably damaging	1.00
IGL02851:Cdh13	APN	8	118675158	missense	probably benign	0.32
IGL02958:Cdh13	APN	8	119312721	missense	possibly damaging	0.90
IGL03085:Cdh13	APN	8	119288724	missense	probably damaging	1.00
IGL03230:Cdh13	APN	8	119242317	missense	probably damaging	1.00
IGL03280:Cdh13	APN	8	119314134	missense	probably damaging	1.00
K3955:Cdh13	UTSW	8	118675104	missense	probably damaging	0.99
P0038:Cdh13	UTSW	8	118675104	missense	probably damaging	0.99
R0398:Cdh13	UTSW	8	119314047	missense	probably damaging	1.00
R2156:Cdh13	UTSW	8	119236964	missense	probably damaging	1.00
R3415:Cdh13	UTSW	8	118675207	missense	probably benign	0.35
R4243:Cdh13	UTSW	8	119242257	missense	probably damaging	1.00
R4839:Cdh13	UTSW	8	118851848	nonsense	probably null
R4851:Cdh13	UTSW	8	118757390	missense	possibly damaging	0.75
R5129:Cdh13	UTSW	8	119095215	missense	probably damaging	1.00
R5453:Cdh13	UTSW	8	119198967	missense	probably damaging	1.00
R5607:Cdh13	UTSW	8	118757474	missense	probably benign
R5608:Cdh13	UTSW	8	118757474	missense	probably benign
R5610:Cdh13	UTSW	8	118851723	missense	possibly damaging	0.95
R6035:Cdh13	UTSW	8	118505698	missense	probably benign	0.03
R6035:Cdh13	UTSW	8	118505698	missense	probably benign	0.03
R6556:Cdh13	UTSW	8	118968187	missense	probably damaging	0.99
R7124:Cdh13	UTSW	8	118968173	missense	probably damaging	1.00
R7349:Cdh13	UTSW	8	119242358	missense	probably damaging	0.97
R7418:Cdh13	UTSW	8	119312525	missense	probably damaging	1.00
R7679:Cdh13	UTSW	8	119236919	missense	probably benign	0.29
R8777:Cdh13	UTSW	8	119236967	critical splice donor site	probably null
R8777-TAIL:Cdh13	UTSW	8	119236967	critical splice donor site	probably null
X0025:Cdh13	UTSW	8	118505679	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TGAAGGAATCCGTCTTGTAAAGCC -3'
(R):5'- TGACCTCGCATCTGAGCTAG -3'

Sequencing Primer
(F):5'- TAAAGCCATTGGTCCTGGTCATCAG -3'
(R):5'- CATCTGAGCTAGCCGGGTATATC -3'

Posted On

2019-11-26