Incidental Mutation 'R6842:Fbxw26'
ID533914
Institutional Source Beutler Lab
Gene Symbol Fbxw26
Ensembl Gene ENSMUSG00000059547
Gene NameF-box and WD-40 domain protein 26
SynonymsGm5163
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6842 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109717566-109746089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109724920 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 217 (I217N)
Ref Sequence ENSEMBL: ENSMUSP00000071811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071917]
Predicted Effect probably damaging
Transcript: ENSMUST00000071917
AA Change: I217N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071811
Gene: ENSMUSG00000059547
AA Change: I217N

DomainStartEndE-ValueType
FBOX 5 45 2.54e-6 SMART
SCOP:d1tbga_ 128 249 1e-5 SMART
Blast:WD40 137 176 4e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,432 N69S probably benign Het
9130011E15Rik A G 19: 45,818,977 V660A probably benign Het
Adgrl3 C T 5: 81,741,080 A1042V probably damaging Het
Armc4 C T 18: 7,268,401 D373N probably benign Het
C1s2 T A 6: 124,627,502 H395L probably benign Het
Cacna1e A G 1: 154,483,117 I307T probably damaging Het
Cap2 T C 13: 46,646,625 S381P probably damaging Het
Cbfa2t2 A G 2: 154,524,045 T392A probably benign Het
Ccdc127 T C 13: 74,356,969 I212T probably damaging Het
Cela3a A G 4: 137,405,668 V91A probably benign Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Csmd2 T C 4: 128,509,159 F2347L possibly damaging Het
Ddx19a A G 8: 110,978,625 V288A possibly damaging Het
Fbxl5 T C 5: 43,773,586 E53G probably damaging Het
Fgfr1op2 T A 6: 146,590,038 probably null Het
Ighv1-37 A T 12: 114,896,655 I6N probably damaging Het
Klhdc10 T C 6: 30,439,782 L128P probably damaging Het
Lypla1 C T 1: 4,832,340 S24F probably benign Het
Mme T A 3: 63,362,044 D591E probably damaging Het
Mmp1b T A 9: 7,384,888 I254F probably damaging Het
Msr1 T C 8: 39,632,825 M5V probably benign Het
Myh8 A G 11: 67,284,655 D312G probably damaging Het
Nav2 T C 7: 49,458,169 Y709H possibly damaging Het
Oas1g T C 5: 120,887,558 E2G probably benign Het
Ocm T A 5: 144,025,691 I6F unknown Het
Olfr160 T C 9: 37,711,589 N230S probably benign Het
Olfr275 T C 4: 52,825,576 Y60H probably damaging Het
Olfr693 T C 7: 106,677,886 Y200C probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pax1 A G 2: 147,373,720 D419G probably benign Het
Plbd1 T A 6: 136,635,614 I194F probably benign Het
Prdx6 A T 1: 161,247,370 C47S probably damaging Het
Sec24d T C 3: 123,343,219 S534P probably benign Het
Sgk3 T C 1: 9,898,754 V452A probably benign Het
Sipa1l1 T C 12: 82,420,546 V1177A probably benign Het
Tgfbr1 T C 4: 47,383,757 C32R probably damaging Het
Trim66 T C 7: 109,460,776 N801S probably benign Het
Utp6 C T 11: 79,940,949 S504N probably benign Het
Wdsub1 A C 2: 59,878,188 S114A probably benign Het
Wfikkn2 T C 11: 94,238,040 E425G probably damaging Het
Zfp956 C T 6: 47,963,829 T374I possibly damaging Het
Other mutations in Fbxw26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Fbxw26 APN 9 109717948 utr 3 prime probably benign
IGL01072:Fbxw26 APN 9 109723837 missense probably damaging 1.00
IGL01151:Fbxw26 APN 9 109721780 missense possibly damaging 0.50
IGL01394:Fbxw26 APN 9 109717989 missense probably benign 0.00
IGL01432:Fbxw26 APN 9 109717975 missense probably benign 0.32
IGL02559:Fbxw26 APN 9 109722164 missense probably benign 0.34
IGL02981:Fbxw26 APN 9 109744794 missense probably benign 0.09
IGL03370:Fbxw26 APN 9 109746019 missense probably damaging 1.00
R0023:Fbxw26 UTSW 9 109718011 missense probably benign 0.01
R0087:Fbxw26 UTSW 9 109724938 missense probably benign
R0369:Fbxw26 UTSW 9 109723712 critical splice donor site probably null
R0446:Fbxw26 UTSW 9 109743720 missense probably benign 0.03
R1844:Fbxw26 UTSW 9 109724878 missense probably benign 0.42
R1891:Fbxw26 UTSW 9 109722164 missense probably benign 0.34
R2042:Fbxw26 UTSW 9 109732704 missense probably damaging 1.00
R3615:Fbxw26 UTSW 9 109743760 nonsense probably null
R3616:Fbxw26 UTSW 9 109743760 nonsense probably null
R4659:Fbxw26 UTSW 9 109744871 missense probably damaging 0.97
R4785:Fbxw26 UTSW 9 109724800 missense possibly damaging 0.50
R4898:Fbxw26 UTSW 9 109717969 missense possibly damaging 0.95
R5791:Fbxw26 UTSW 9 109745153 missense probably damaging 1.00
R5818:Fbxw26 UTSW 9 109732566 missense probably benign
R5921:Fbxw26 UTSW 9 109746018 missense probably damaging 1.00
R5983:Fbxw26 UTSW 9 109717965 missense possibly damaging 0.49
R6145:Fbxw26 UTSW 9 109732623 missense probably benign 0.09
R6209:Fbxw26 UTSW 9 109717965 missense possibly damaging 0.49
R6412:Fbxw26 UTSW 9 109732647 missense probably damaging 0.97
R7228:Fbxw26 UTSW 9 109724944 missense possibly damaging 0.93
R7451:Fbxw26 UTSW 9 109732623 missense probably benign 0.03
R7467:Fbxw26 UTSW 9 109732697 missense probably benign 0.00
X0020:Fbxw26 UTSW 9 109732632 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAGGACTGGAATTTCCC -3'
(R):5'- AGATCTAGAGAGTCTTACTCCATGG -3'

Sequencing Primer
(F):5'- GAGGACTGGAATTTCCCACTGTC -3'
(R):5'- GAGTCTTACTCCATGGAATCAGTGC -3'
Posted On2018-09-12