Mutagenetix > Incidental Mutation

Incidental Mutation 'R6836:Ncan'

534571

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6836 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70100315 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1089 (S1089N)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002412
AA Change: S1089N

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: S1089N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,196,504	I81F	possibly damaging	Het
Adamtsl2	T	C	2: 27,081,706	M1T	probably null	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Alox8	T	C	11: 69,186,505	Y473C	probably damaging	Het
Alox8	T	C	11: 69,189,889	R209G	possibly damaging	Het
Asb5	A	G	8: 54,585,071	M210V	probably benign	Het
Atp2c2	T	A	8: 119,734,415	L249Q	probably damaging	Het
AU018091	T	G	7: 3,164,156	D77A	probably damaging	Het
Bahcc1	A	T	11: 120,271,757	K294*	probably null	Het
Baz2b	C	T	2: 59,917,425	R1298Q	probably damaging	Het
Bivm	T	A	1: 44,143,136	N501K	possibly damaging	Het
Bpifb5	T	A	2: 154,228,065	I145N	probably benign	Het
Casq2	A	T	3: 102,086,760	N41I	probably damaging	Het
Ccdc18	T	C	5: 108,197,967	L993P	probably damaging	Het
Cfap44	A	G	16: 44,404,079	D50G	probably damaging	Het
Clca3a2	T	A	3: 144,806,383	I91F	probably damaging	Het
Crebbp	T	A	16: 4,180,022	H66L	possibly damaging	Het
Cyfip2	T	C	11: 46,272,640	T321A	probably benign	Het
Dido1	A	G	2: 180,662,307	V1268A	probably benign	Het
E030030I06Rik	A	C	10: 22,148,492	V174G	probably damaging	Het
Gm20730	G	T	6: 43,081,833		probably null	Het
Gm36176	T	C	10: 77,847,142		probably benign	Het
Gper1	T	A	5: 139,426,680	M260K	probably damaging	Het
Igfbp2	T	C	1: 72,849,658	L89P	probably damaging	Het
Katnal1	T	C	5: 148,894,164	N200S	probably damaging	Het
Kcnk13	G	T	12: 100,061,689	R341L	probably damaging	Het
Klhl20	T	A	1: 161,105,406	E277D	probably benign	Het
Lingo1	T	C	9: 56,619,772	Y517C	probably damaging	Het
Lrrk1	C	T	7: 66,342,779	E82K	probably benign	Het
Mtor	T	A	4: 148,489,498	V1275D	possibly damaging	Het
Notch4	C	T	17: 34,586,100	T1643I	probably damaging	Het
Olfr1258	T	C	2: 89,930,339	C177R	probably damaging	Het
Olfr1357	A	G	10: 78,612,590	L17P	probably damaging	Het
Olfr1387	A	T	11: 49,460,077	T133S	possibly damaging	Het
Olfr539	A	C	7: 140,668,180	I298L	possibly damaging	Het
Pcdhgb6	T	C	18: 37,742,962	V241A	probably benign	Het
Phf11b	T	A	14: 59,328,123	T102S	possibly damaging	Het
Pkd1	T	A	17: 24,581,259	V2998E	probably damaging	Het
Ppp1r13b	T	C	12: 111,835,195	S352G	probably benign	Het
Ptprh	C	T	7: 4,551,135	V778M	probably damaging	Het
Ptprz1	C	T	6: 23,030,665	Q1008*	probably null	Het
Ralgapa1	A	T	12: 55,604,273		probably null	Het
Rbm20	G	A	19: 53,814,069	G336E	probably damaging	Het
Sdsl	T	C	5: 120,462,102	I77V	probably benign	Het
Serpina3b	G	A	12: 104,134,082	E308K	probably benign	Het
Sfrp5	G	A	19: 42,201,710	T101I	probably damaging	Het
Slc2a13	C	T	15: 91,321,632	V451I	probably benign	Het
Slc6a9	C	T	4: 117,867,886	A559V	possibly damaging	Het
Spg11	C	T	2: 122,059,535	A2109T	probably damaging	Het
Stard9	C	T	2: 120,699,843	R2194C	probably benign	Het
Tfeb	T	C	17: 47,786,198		probably null	Het
Tiam2	T	A	17: 3,414,380	I128N	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tpr	T	G	1: 150,436,673		probably null	Het
Traf3ip1	T	C	1: 91,521,000	I456T	probably benign	Het
Ttll4	T	A	1: 74,689,413	D892E	probably damaging	Het
Ubr1	T	A	2: 120,896,675		probably null	Het
Vmn2r74	T	A	7: 85,957,422	I239F	probably benign	Het
Wdfy3	C	T	5: 101,952,999	V251M	probably damaging	Het
Xylb	T	A	9: 119,391,754	L531H	probably damaging	Het
Zfp960	T	A	17: 17,088,172	C383S	probably damaging	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCCACCAGTGAGTGATTG -3'
(R):5'- ACCTGTGTGAACTGTGTGGC -3'

Sequencing Primer
(F):5'- CCCACCAGTGAGTGATTGTTTCATAG -3'
(R):5'- GGTCTCCTGACTCACAAGC -3'

Posted On

2018-09-12