Incidental Mutation 'R6836:Tiam2'
ID534592
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6836 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3414380 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 128 (I128N)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838]
Predicted Effect probably benign
Transcript: ENSMUST00000072156
AA Change: I128N

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: I128N

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169838
AA Change: I128N

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: I128N

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Meta Mutation Damage Score 0.2889 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Alox8 T C 11: 69,186,505 Y473C probably damaging Het
Alox8 T C 11: 69,189,889 R209G possibly damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
AU018091 T G 7: 3,164,156 D77A probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Cfap44 A G 16: 44,404,079 D50G probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L89P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Phf11b T A 14: 59,328,123 T102S possibly damaging Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprh C T 7: 4,551,135 V778M probably damaging Het
Ptprz1 C T 6: 23,030,665 Q1008* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpr T G 1: 150,436,673 probably null Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7925:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 intron probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTCTCACTTTAAGAATCACCAG -3'
(R):5'- TATCTCAGCAGCCGTACAGG -3'

Sequencing Primer
(F):5'- TTTAAGAATCACCAGCCTTACGC -3'
(R):5'- AGCAGCCGTACAGGTCCAC -3'
Posted On2018-09-12