Incidental Mutation 'R6864:Slc35f4'
ID535830
Institutional Source Beutler Lab
Gene Symbol Slc35f4
Ensembl Gene ENSMUSG00000021852
Gene Namesolute carrier family 35, member F4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location49298519-49526046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49318853 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 148 (I148V)
Ref Sequence ENSEMBL: ENSMUSP00000122405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074368] [ENSMUST00000123534] [ENSMUST00000138884] [ENSMUST00000146164]
Predicted Effect probably benign
Transcript: ENSMUST00000074368
AA Change: I148V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073972
Gene: ENSMUSG00000021852
AA Change: I148V

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:SLC35F 216 435 7.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123534
AA Change: I148V

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122405
Gene: ENSMUSG00000021852
AA Change: I148V

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
transmembrane domain 217 234 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138884
SMART Domains Protein: ENSMUSP00000119007
Gene: ENSMUSG00000021852

DomainStartEndE-ValueType
Pfam:EmrE 18 143 1e-12 PFAM
Pfam:EamA 57 135 8.4e-9 PFAM
Pfam:DUF914 68 314 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146164
AA Change: I148V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Slc35f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc35f4 APN 14 49298877 missense probably benign 0.15
IGL01640:Slc35f4 APN 14 49318768 missense probably damaging 0.99
IGL01942:Slc35f4 APN 14 49525505 splice site probably benign
IGL01990:Slc35f4 APN 14 49304169 critical splice donor site probably null
IGL02097:Slc35f4 APN 14 49306246 missense probably damaging 1.00
IGL02803:Slc35f4 APN 14 49304257 missense probably benign 0.00
R0005:Slc35f4 UTSW 14 49322486 splice site probably benign
R0238:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0238:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0764:Slc35f4 UTSW 14 49306339 splice site probably benign
R1884:Slc35f4 UTSW 14 49313634 missense probably damaging 1.00
R1916:Slc35f4 UTSW 14 49303923 intron probably benign
R2047:Slc35f4 UTSW 14 49303572 intron probably benign
R2239:Slc35f4 UTSW 14 49306203 critical splice donor site probably null
R2380:Slc35f4 UTSW 14 49306203 critical splice donor site probably null
R4273:Slc35f4 UTSW 14 49304301 missense possibly damaging 0.81
R4420:Slc35f4 UTSW 14 49313577 unclassified probably benign
R4425:Slc35f4 UTSW 14 49318850 missense possibly damaging 0.85
R5261:Slc35f4 UTSW 14 49303489 intron probably benign
R5398:Slc35f4 UTSW 14 49298847 missense probably damaging 1.00
R5402:Slc35f4 UTSW 14 49318874 missense probably damaging 1.00
R6310:Slc35f4 UTSW 14 49322457 missense probably damaging 1.00
R6596:Slc35f4 UTSW 14 49525600 missense probably damaging 1.00
R6729:Slc35f4 UTSW 14 49318960 missense probably benign 0.16
R7427:Slc35f4 UTSW 14 49298898 missense probably damaging 0.99
R7428:Slc35f4 UTSW 14 49298898 missense probably damaging 0.99
R7559:Slc35f4 UTSW 14 49304275 missense probably benign 0.03
R7596:Slc35f4 UTSW 14 49306209 missense probably damaging 1.00
R7722:Slc35f4 UTSW 14 49306274 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGACCTGAGGTAAGGGACAC -3'
(R):5'- AGCTGACACATCTGACTGCTC -3'

Sequencing Primer
(F):5'- TAAGGGGGCTCATCCTGCTTC -3'
(R):5'- GACACATCTGACTGCTCCTCCAC -3'
Posted On2018-10-18