Mutagenetix > Incidental Mutations

Incidental Mutation 'R6864:Plekhh2'

535838

Institutional Source

Beutler Lab

Gene Symbol

Plekhh2

Ensembl Gene

ENSMUSG00000040852

Gene Name

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R6864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84511895-84622142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84617999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1408 (V1408A)

Ref Sequence

ENSEMBL: ENSMUSP00000039628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047206]

AlphaFold

Q8C115

Predicted Effect

probably benign
Transcript: ENSMUST00000047206
AA Change: V1408A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: V1408A

Domain	Start	End	E-Value	Type
coiled coil region	19	84	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
coiled coil region	137	174	N/A	INTRINSIC
low complexity region	427	442	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
low complexity region	612	651	N/A	INTRINSIC
low complexity region	657	666	N/A	INTRINSIC
PH	703	798	4.7e-19	SMART
PH	811	920	1.15e-4	SMART
MyTH4	954	1109	8.49e-39	SMART
B41	1116	1353	1.01e-27	SMART

Meta Mutation Damage Score

0.1289

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre1	C	T	17: 57,478,879	T875I	probably damaging	Het
Anln	A	T	9: 22,382,249	S33T	probably benign	Het
Anxa6	T	C	11: 54,986,185	T541A	probably benign	Het
Atxn2	C	T	5: 121,779,494	R334W	probably damaging	Het
AU040320	T	A	4: 126,847,819	V940D	probably damaging	Het
Bcl2	A	T	1: 106,543,281	Y232N	probably damaging	Het
Bmp7	A	G	2: 172,940,062	V3A	probably benign	Het
Calr	A	T	8: 84,844,928	H145Q	probably damaging	Het
Camta2	T	A	11: 70,671,966	T976S	probably benign	Het
Ccnk	G	A	12: 108,202,214		probably benign	Het
Cntln	T	C	4: 85,096,792	S1107P	probably damaging	Het
Cradd	T	C	10: 95,175,927	D117G	probably damaging	Het
Dcaf7	C	T	11: 106,046,821	T90I	probably damaging	Het
Defb30	T	A	14: 63,036,103		probably null	Het
Dock4	T	A	12: 40,745,746	I854N	probably damaging	Het
Dym	T	A	18: 75,056,738	Y132*	probably null	Het
Eef1a2	T	C	2: 181,149,684	T341A	probably benign	Het
Eml2	T	C	7: 19,196,281	V309A	probably damaging	Het
Fam208a	T	A	14: 27,461,158	F525I	probably damaging	Het
Flnb	C	T	14: 7,905,640	P1130L	possibly damaging	Het
Hivep3	C	A	4: 120,094,888	Q134K	possibly damaging	Het
Kbtbd2	T	A	6: 56,780,026	K242*	probably null	Het
Kel	A	G	6: 41,703,760		probably null	Het
Lcorl	T	A	5: 45,747,204	K177N	probably damaging	Het
Mbd3l2	A	G	9: 18,443,499		probably benign	Het
Mcm3ap	A	G	10: 76,507,479	D1735G	probably damaging	Het
Ms4a1	C	A	19: 11,253,178		probably null	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Mylk	C	A	16: 34,874,150	P193Q	probably benign	Het
Olfr1275	C	T	2: 111,231,197	V199I	probably benign	Het
Olfr1388	G	T	11: 49,443,940	A30S	probably benign	Het
Olfr1390	A	T	11: 49,340,753	T74S	probably damaging	Het
Olfr1424	A	T	19: 12,059,413	F113Y	probably damaging	Het
Olfr339	T	A	2: 36,421,820	C141S	probably damaging	Het
Otogl	C	T	10: 107,827,806	S968N	probably damaging	Het
Oxr1	T	G	15: 41,823,387	V555G	probably damaging	Het
Parp12	T	C	6: 39,111,736	I189V	probably benign	Het
Peg3	T	C	7: 6,712,762	Y103C	probably damaging	Het
Prkacb	T	C	3: 146,745,378	Y204C	probably damaging	Het
Prkch	A	G	12: 73,759,617	E546G	probably damaging	Het
Prss12	C	A	3: 123,447,384	H76N	probably benign	Het
Rai14	G	T	15: 10,633,168	S45R	possibly damaging	Het
Samd9l	T	A	6: 3,374,750	D837V	probably benign	Het
Slc22a6	G	T	19: 8,618,441	C49F	probably damaging	Het
Slc2a2	T	A	3: 28,721,725	I328N	probably damaging	Het
Slc35f4	T	C	14: 49,318,853	I148V	possibly damaging	Het
Stk32b	A	T	5: 37,448,805		probably null	Het
Tktl2	T	C	8: 66,512,339	I183T	probably damaging	Het
Tmem175	A	C	5: 108,645,979	H325P	probably damaging	Het
Tns3	A	G	11: 8,493,196	V389A	probably damaging	Het
Trappc9	A	T	15: 72,937,162		probably null	Het
Trim28	T	A	7: 13,029,458	F509I	possibly damaging	Het
Vmn1r210	T	A	13: 22,827,543	Q191L	probably benign	Het
Vmn2r24	A	T	6: 123,779,158	D63V	possibly damaging	Het
Zfp536	A	G	7: 37,568,515	L492P	probably damaging	Het
Zfp831	C	A	2: 174,646,740	N1069K	possibly damaging	Het
Zfp943	T	A	17: 21,992,612	H226Q	probably damaging	Het

Other mutations in Plekhh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Plekhh2	APN	17	84521775	missense	probably benign	0.00
IGL00514:Plekhh2	APN	17	84596306	critical splice donor site	probably null
IGL00773:Plekhh2	APN	17	84606868	missense	probably benign	0.01
IGL00985:Plekhh2	APN	17	84563928	missense	probably benign	0.00
IGL01116:Plekhh2	APN	17	84606928	missense	possibly damaging	0.94
IGL01394:Plekhh2	APN	17	84557430	missense	probably benign	0.24
IGL01419:Plekhh2	APN	17	84583552	splice site	probably benign
IGL01932:Plekhh2	APN	17	84577261	missense	probably benign	0.00
IGL02097:Plekhh2	APN	17	84599180	missense	possibly damaging	0.69
IGL02157:Plekhh2	APN	17	84566942	splice site	probably benign
IGL02163:Plekhh2	APN	17	84590795	missense	probably benign	0.45
IGL02237:Plekhh2	APN	17	84575785	missense	probably benign	0.00
IGL02322:Plekhh2	APN	17	84589466	nonsense	probably null
IGL02422:Plekhh2	APN	17	84563809	splice site	probably benign
IGL02483:Plekhh2	APN	17	84596260	missense	possibly damaging	0.81
IGL02493:Plekhh2	APN	17	84606963	critical splice donor site	probably null
IGL03007:Plekhh2	APN	17	84574960	missense	possibly damaging	0.65
R0003:Plekhh2	UTSW	17	84557392	missense	probably damaging	1.00
R0005:Plekhh2	UTSW	17	84586433	missense	probably benign	0.16
R0099:Plekhh2	UTSW	17	84591672	nonsense	probably null
R0331:Plekhh2	UTSW	17	84586366	missense	possibly damaging	0.81
R0883:Plekhh2	UTSW	17	84618031	missense	probably benign	0.11
R1051:Plekhh2	UTSW	17	84521827	critical splice donor site	probably null
R1084:Plekhh2	UTSW	17	84571126	missense	probably damaging	0.99
R1351:Plekhh2	UTSW	17	84577146	splice site	probably benign
R1459:Plekhh2	UTSW	17	84610775	nonsense	probably null
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1510:Plekhh2	UTSW	17	84559576	splice site	probably null
R1699:Plekhh2	UTSW	17	84577184	nonsense	probably null
R1738:Plekhh2	UTSW	17	84566697	missense	possibly damaging	0.67
R1773:Plekhh2	UTSW	17	84599265	missense	probably damaging	1.00
R1796:Plekhh2	UTSW	17	84599133	critical splice acceptor site	probably null
R1823:Plekhh2	UTSW	17	84575189	missense	probably damaging	1.00
R1998:Plekhh2	UTSW	17	84606877	missense	possibly damaging	0.58
R2437:Plekhh2	UTSW	17	84586479	splice site	probably null
R2847:Plekhh2	UTSW	17	84597966	missense	probably damaging	1.00
R4088:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R4227:Plekhh2	UTSW	17	84566795	missense	probably benign	0.00
R4249:Plekhh2	UTSW	17	84586337	missense	possibly damaging	0.93
R4347:Plekhh2	UTSW	17	84619702	missense	probably benign	0.12
R4562:Plekhh2	UTSW	17	84566097	missense	probably benign	0.00
R4649:Plekhh2	UTSW	17	84575263	missense	probably damaging	1.00
R4737:Plekhh2	UTSW	17	84563959	missense	probably benign
R4743:Plekhh2	UTSW	17	84571120	missense	probably damaging	1.00
R4858:Plekhh2	UTSW	17	84600697	missense	probably damaging	1.00
R5036:Plekhh2	UTSW	17	84571761	missense	probably damaging	0.99
R5260:Plekhh2	UTSW	17	84577165	missense	probably damaging	0.99
R5385:Plekhh2	UTSW	17	84557466	missense	probably benign	0.00
R5409:Plekhh2	UTSW	17	84586478	critical splice donor site	probably null
R5510:Plekhh2	UTSW	17	84566847	missense	probably benign
R5557:Plekhh2	UTSW	17	84560152	missense	probably benign	0.10
R5684:Plekhh2	UTSW	17	84597918	missense	probably damaging	1.00
R5685:Plekhh2	UTSW	17	84569882	missense	probably damaging	1.00
R5724:Plekhh2	UTSW	17	84566805	missense	probably benign	0.00
R5742:Plekhh2	UTSW	17	84597980	missense	probably damaging	1.00
R5817:Plekhh2	UTSW	17	84571726	missense	possibly damaging	0.86
R6218:Plekhh2	UTSW	17	84591564	missense	probably benign	0.03
R6334:Plekhh2	UTSW	17	84566866	missense	probably benign
R6345:Plekhh2	UTSW	17	84575787	missense	probably benign	0.01
R6617:Plekhh2	UTSW	17	84566287	missense	possibly damaging	0.65
R6755:Plekhh2	UTSW	17	84591585	missense	probably damaging	1.00
R7171:Plekhh2	UTSW	17	84521788	missense	probably damaging	0.96
R7413:Plekhh2	UTSW	17	84566296	missense	probably benign	0.03
R7585:Plekhh2	UTSW	17	84577180	missense	probably benign	0.11
R7640:Plekhh2	UTSW	17	84610776	missense	possibly damaging	0.50
R7733:Plekhh2	UTSW	17	84583524	nonsense	probably null
R7877:Plekhh2	UTSW	17	84575006	missense	probably benign
R8085:Plekhh2	UTSW	17	84597956	missense	probably damaging	0.98
R8206:Plekhh2	UTSW	17	84590849	missense	possibly damaging	0.47
R8296:Plekhh2	UTSW	17	84600685	missense	probably damaging	0.98
R8344:Plekhh2	UTSW	17	84571761	missense	possibly damaging	0.64
R8438:Plekhh2	UTSW	17	84569951	missense	probably benign
R8487:Plekhh2	UTSW	17	84557481	missense	possibly damaging	0.55
R8708:Plekhh2	UTSW	17	84574993	missense	probably benign	0.00
R8830:Plekhh2	UTSW	17	84521803	missense	probably damaging	1.00
R8847:Plekhh2	UTSW	17	84571051	missense	probably benign	0.00
R8918:Plekhh2	UTSW	17	84599193	missense	possibly damaging	0.80
R9047:Plekhh2	UTSW	17	84590762	missense	probably damaging	0.99
R9404:Plekhh2	UTSW	17	84571040	critical splice acceptor site	probably null
R9428:Plekhh2	UTSW	17	84566413	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATGGTATAGGTTGACGATCCC -3'
(R):5'- CTTGGAACTTCCTGTCACCAG -3'

Sequencing Primer
(F):5'- TGTATCTGTATCCGCGTT -3'
(R):5'- CAGGTGTTGGCCCACTTG -3'

Posted On

2018-10-18