Incidental Mutation 'R6864:Plekhh2'
ID535838
Institutional Source Beutler Lab
Gene Symbol Plekhh2
Ensembl Gene ENSMUSG00000040852
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6864 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location84511895-84622142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84617999 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1408 (V1408A)
Ref Sequence ENSEMBL: ENSMUSP00000039628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047206]
Predicted Effect probably benign
Transcript: ENSMUST00000047206
AA Change: V1408A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: V1408A

DomainStartEndE-ValueType
coiled coil region 19 84 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
coiled coil region 137 174 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
low complexity region 612 651 N/A INTRINSIC
low complexity region 657 666 N/A INTRINSIC
PH 703 798 4.7e-19 SMART
PH 811 920 1.15e-4 SMART
MyTH4 954 1109 8.49e-39 SMART
B41 1116 1353 1.01e-27 SMART
Meta Mutation Damage Score 0.1289 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Prss12 C A 3: 123,447,384 H76N probably benign Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Plekhh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Plekhh2 APN 17 84521775 missense probably benign 0.00
IGL00514:Plekhh2 APN 17 84596306 critical splice donor site probably null
IGL00773:Plekhh2 APN 17 84606868 missense probably benign 0.01
IGL00985:Plekhh2 APN 17 84563928 missense probably benign 0.00
IGL01116:Plekhh2 APN 17 84606928 missense possibly damaging 0.94
IGL01394:Plekhh2 APN 17 84557430 missense probably benign 0.24
IGL01419:Plekhh2 APN 17 84583552 splice site probably benign
IGL01932:Plekhh2 APN 17 84577261 missense probably benign 0.00
IGL02097:Plekhh2 APN 17 84599180 missense possibly damaging 0.69
IGL02157:Plekhh2 APN 17 84566942 splice site probably benign
IGL02163:Plekhh2 APN 17 84590795 missense probably benign 0.45
IGL02237:Plekhh2 APN 17 84575785 missense probably benign 0.00
IGL02322:Plekhh2 APN 17 84589466 nonsense probably null
IGL02422:Plekhh2 APN 17 84563809 splice site probably benign
IGL02483:Plekhh2 APN 17 84596260 missense possibly damaging 0.81
IGL02493:Plekhh2 APN 17 84606963 critical splice donor site probably null
IGL03007:Plekhh2 APN 17 84574960 missense possibly damaging 0.65
R0003:Plekhh2 UTSW 17 84557392 missense probably damaging 1.00
R0005:Plekhh2 UTSW 17 84586433 missense probably benign 0.16
R0099:Plekhh2 UTSW 17 84591672 nonsense probably null
R0331:Plekhh2 UTSW 17 84586366 missense possibly damaging 0.81
R0883:Plekhh2 UTSW 17 84618031 missense probably benign 0.11
R1051:Plekhh2 UTSW 17 84521827 critical splice donor site probably null
R1084:Plekhh2 UTSW 17 84571126 missense probably damaging 0.99
R1351:Plekhh2 UTSW 17 84577146 splice site probably benign
R1459:Plekhh2 UTSW 17 84610775 nonsense probably null
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1510:Plekhh2 UTSW 17 84559576 splice site probably null
R1699:Plekhh2 UTSW 17 84577184 nonsense probably null
R1738:Plekhh2 UTSW 17 84566697 missense possibly damaging 0.67
R1773:Plekhh2 UTSW 17 84599265 missense probably damaging 1.00
R1796:Plekhh2 UTSW 17 84599133 critical splice acceptor site probably null
R1823:Plekhh2 UTSW 17 84575189 missense probably damaging 1.00
R1998:Plekhh2 UTSW 17 84606877 missense possibly damaging 0.58
R2437:Plekhh2 UTSW 17 84586479 splice site probably null
R2847:Plekhh2 UTSW 17 84597966 missense probably damaging 1.00
R4088:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R4227:Plekhh2 UTSW 17 84566795 missense probably benign 0.00
R4249:Plekhh2 UTSW 17 84586337 missense possibly damaging 0.93
R4347:Plekhh2 UTSW 17 84619702 missense probably benign 0.12
R4562:Plekhh2 UTSW 17 84566097 missense probably benign 0.00
R4649:Plekhh2 UTSW 17 84575263 missense probably damaging 1.00
R4737:Plekhh2 UTSW 17 84563959 missense probably benign
R4743:Plekhh2 UTSW 17 84571120 missense probably damaging 1.00
R4858:Plekhh2 UTSW 17 84600697 missense probably damaging 1.00
R5036:Plekhh2 UTSW 17 84571761 missense probably damaging 0.99
R5260:Plekhh2 UTSW 17 84577165 missense probably damaging 0.99
R5385:Plekhh2 UTSW 17 84557466 missense probably benign 0.00
R5409:Plekhh2 UTSW 17 84586478 critical splice donor site probably null
R5510:Plekhh2 UTSW 17 84566847 missense probably benign
R5557:Plekhh2 UTSW 17 84560152 missense probably benign 0.10
R5684:Plekhh2 UTSW 17 84597918 missense probably damaging 1.00
R5685:Plekhh2 UTSW 17 84569882 missense probably damaging 1.00
R5724:Plekhh2 UTSW 17 84566805 missense probably benign 0.00
R5742:Plekhh2 UTSW 17 84597980 missense probably damaging 1.00
R5817:Plekhh2 UTSW 17 84571726 missense possibly damaging 0.86
R6218:Plekhh2 UTSW 17 84591564 missense probably benign 0.03
R6334:Plekhh2 UTSW 17 84566866 missense probably benign
R6345:Plekhh2 UTSW 17 84575787 missense probably benign 0.01
R6617:Plekhh2 UTSW 17 84566287 missense possibly damaging 0.65
R6755:Plekhh2 UTSW 17 84591585 missense probably damaging 1.00
R7171:Plekhh2 UTSW 17 84521788 missense probably damaging 0.96
R7413:Plekhh2 UTSW 17 84566296 missense probably benign 0.03
R7585:Plekhh2 UTSW 17 84577180 missense probably benign 0.11
R7640:Plekhh2 UTSW 17 84610776 missense possibly damaging 0.50
R7733:Plekhh2 UTSW 17 84583524 nonsense probably null
R7877:Plekhh2 UTSW 17 84575006 missense probably benign
R7960:Plekhh2 UTSW 17 84575006 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGGTATAGGTTGACGATCCC -3'
(R):5'- CTTGGAACTTCCTGTCACCAG -3'

Sequencing Primer
(F):5'- TGTATCTGTATCCGCGTT -3'
(R):5'- CAGGTGTTGGCCCACTTG -3'
Posted On2018-10-18