Incidental Mutation 'R6945:Olfr1040'
ID 540826
Institutional Source Beutler Lab
Gene Symbol Olfr1040
Ensembl Gene ENSMUSG00000075203
Gene Name olfactory receptor 1040
Synonyms MOR185-12, GA_x6K02T2Q125-47615732-47614791
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R6945 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 86145791-86146732 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86146084 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 217 (S217P)
Ref Sequence ENSEMBL: ENSMUSP00000097493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099909]
AlphaFold A2ARY1
Predicted Effect probably damaging
Transcript: ENSMUST00000099909
AA Change: S217P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097493
Gene: ENSMUSG00000075203
AA Change: S217P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-48 PFAM
Pfam:7tm_1 41 290 5.1e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A C 5: 109,676,845 N246K probably benign Het
AA792892 C T 5: 94,383,631 H125Y possibly damaging Het
Abcc5 T A 16: 20,400,009 T208S probably benign Het
Acaa2 A G 18: 74,793,309 E112G probably benign Het
Adgrb1 A G 15: 74,550,024 N881S probably damaging Het
Adgre1 A G 17: 57,410,844 E314G probably benign Het
Adgre1 A G 17: 57,420,399 E443G probably benign Het
Akp3 A G 1: 87,125,631 Y102C probably damaging Het
Birc6 A G 17: 74,579,531 N618S probably benign Het
Bpifc A G 10: 85,979,214 V296A probably benign Het
Cacna2d3 G A 14: 28,969,318 probably benign Het
Cacnb4 T C 2: 52,474,954 N99S probably damaging Het
Cd38 A G 5: 43,908,006 Y283C probably damaging Het
Celf4 T A 18: 25,496,236 Q411L probably damaging Het
Cemip A T 7: 83,998,547 H108Q probably damaging Het
Col23a1 A G 11: 51,561,893 E225G unknown Het
Dnah11 T C 12: 118,060,310 E1902G probably damaging Het
Dst A G 1: 34,190,490 D2063G probably damaging Het
Fsip2 A T 2: 82,992,840 I6306L probably benign Het
Furin A G 7: 80,391,090 S667P possibly damaging Het
Glmp T A 3: 88,325,832 S92R probably benign Het
Gm11563 C G 11: 99,658,472 C152S unknown Het
Gm3486 A G 14: 41,484,561 V185A probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Hyal1 C A 9: 107,579,170 A102E probably damaging Het
Invs T C 4: 48,421,785 C806R probably benign Het
L1td1 T C 4: 98,733,696 V165A probably benign Het
Lama1 A G 17: 67,813,866 T2666A Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc8a A G 2: 30,256,227 Y351C probably damaging Het
Myh7b T C 2: 155,622,232 F551S possibly damaging Het
Myo19 A G 11: 84,897,560 T333A probably benign Het
Nrp2 A T 1: 62,760,788 N387I probably damaging Het
Oas2 T C 5: 120,736,139 D543G probably benign Het
Olfr117 A G 17: 37,659,514 I273T possibly damaging Het
Pak7 A G 2: 136,100,939 V427A probably benign Het
Pfas G A 11: 69,000,530 A247V probably benign Het
Psat1 T A 19: 15,917,181 T115S probably benign Het
Psme4 T A 11: 30,837,437 D1077E probably benign Het
Rabgap1l A G 1: 160,682,182 S442P probably benign Het
Ralgapa1 A G 12: 55,776,191 M280T possibly damaging Het
Rb1cc1 A T 1: 6,261,032 E394D probably damaging Het
Seh1l T C 18: 67,789,390 V271A probably benign Het
Sf3b1 A T 1: 54,997,156 N919K probably benign Het
Sftpd A G 14: 41,174,492 S245P possibly damaging Het
Slc22a15 T C 3: 101,924,114 E2G probably damaging Het
Spta1 A G 1: 174,209,325 D1134G possibly damaging Het
Syna A G 5: 134,558,961 V378A probably damaging Het
Tchp A G 5: 114,709,350 K77E possibly damaging Het
Tescl T C 7: 24,333,531 N123S probably benign Het
Trio C T 15: 27,824,090 R1443Q probably damaging Het
Trrap A T 5: 144,790,855 Y462F possibly damaging Het
Vmn1r78 A G 7: 12,152,905 T148A probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Olfr1040
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1040 APN 2 86146611 missense probably benign 0.22
IGL01106:Olfr1040 APN 2 86146216 missense probably benign 0.09
IGL02193:Olfr1040 APN 2 86146715 missense probably benign 0.00
IGL02730:Olfr1040 APN 2 86146099 missense probably benign 0.05
IGL03032:Olfr1040 APN 2 86146699 missense probably damaging 1.00
IGL03165:Olfr1040 APN 2 86146068 missense possibly damaging 0.91
R0388:Olfr1040 UTSW 2 86146630 missense probably damaging 1.00
R2971:Olfr1040 UTSW 2 86146564 missense probably damaging 0.96
R4168:Olfr1040 UTSW 2 86146179 missense probably benign 0.03
R4532:Olfr1040 UTSW 2 86145930 missense possibly damaging 0.77
R5024:Olfr1040 UTSW 2 86146533 missense probably damaging 1.00
R5175:Olfr1040 UTSW 2 86145957 missense probably damaging 1.00
R5574:Olfr1040 UTSW 2 86146191 missense probably damaging 1.00
R6033:Olfr1040 UTSW 2 86146269 missense probably damaging 0.97
R6033:Olfr1040 UTSW 2 86146269 missense probably damaging 0.97
R6137:Olfr1040 UTSW 2 86145969 missense probably benign
R6980:Olfr1040 UTSW 2 86146337 nonsense probably null
R7065:Olfr1040 UTSW 2 86146001 missense probably damaging 1.00
R8264:Olfr1040 UTSW 2 86146194 missense probably damaging 1.00
R9039:Olfr1040 UTSW 2 86146281 missense probably damaging 1.00
R9224:Olfr1040 UTSW 2 86145876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTAGATCAGTGGGTTTAACATG -3'
(R):5'- TTCAGGCAGTGGCAACCTTC -3'

Sequencing Primer
(F):5'- GGGTTTAACATGGGAATTACTACCAC -3'
(R):5'- GCAGTGGCAACCTTCCACTTC -3'
Posted On 2018-11-28