Mutagenetix > Incidental Mutations

Incidental Mutation 'R6945:Olfr1040'

540826

Institutional Source

Beutler Lab

Gene Symbol

Olfr1040

Ensembl Gene

ENSMUSG00000075203

Gene Name

olfactory receptor 1040

Synonyms

MOR185-12, GA_x6K02T2Q125-47615732-47614791

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86145791-86146732 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86146084 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 217 (S217P)

Ref Sequence

ENSEMBL: ENSMUSP00000097493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099909]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099909
AA Change: S217P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097493
Gene: ENSMUSG00000075203
AA Change: S217P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	8.2e-48	PFAM
Pfam:7tm_1	41	290	5.1e-16	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Akp3	A	G	1: 87,125,631	Y102C	probably damaging	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Olfr1040

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01081:Olfr1040	APN	2	86146611	missense	probably benign	0.22
IGL01106:Olfr1040	APN	2	86146216	missense	probably benign	0.09
IGL02193:Olfr1040	APN	2	86146715	missense	probably benign	0.00
IGL02730:Olfr1040	APN	2	86146099	missense	probably benign	0.05
IGL03032:Olfr1040	APN	2	86146699	missense	probably damaging	1.00
IGL03165:Olfr1040	APN	2	86146068	missense	possibly damaging	0.91
R0388:Olfr1040	UTSW	2	86146630	missense	probably damaging	1.00
R2971:Olfr1040	UTSW	2	86146564	missense	probably damaging	0.96
R4168:Olfr1040	UTSW	2	86146179	missense	probably benign	0.03
R4532:Olfr1040	UTSW	2	86145930	missense	possibly damaging	0.77
R5024:Olfr1040	UTSW	2	86146533	missense	probably damaging	1.00
R5175:Olfr1040	UTSW	2	86145957	missense	probably damaging	1.00
R5574:Olfr1040	UTSW	2	86146191	missense	probably damaging	1.00
R6033:Olfr1040	UTSW	2	86146269	missense	probably damaging	0.97
R6033:Olfr1040	UTSW	2	86146269	missense	probably damaging	0.97
R6137:Olfr1040	UTSW	2	86145969	missense	probably benign
R6980:Olfr1040	UTSW	2	86146337	nonsense	probably null
R7065:Olfr1040	UTSW	2	86146001	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGTAGATCAGTGGGTTTAACATG -3'
(R):5'- TTCAGGCAGTGGCAACCTTC -3'

Sequencing Primer
(F):5'- GGGTTTAACATGGGAATTACTACCAC -3'
(R):5'- GCAGTGGCAACCTTCCACTTC -3'

Posted On

2018-11-28