Incidental Mutation 'R6137:Olfr1040'
ID488387
Institutional Source Beutler Lab
Gene Symbol Olfr1040
Ensembl Gene ENSMUSG00000075203
Gene Nameolfactory receptor 1040
SynonymsMOR185-12, GA_x6K02T2Q125-47615732-47614791
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6137 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86145791-86146732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86145969 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 255 (V255A)
Ref Sequence ENSEMBL: ENSMUSP00000097493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099909]
Predicted Effect probably benign
Transcript: ENSMUST00000099909
AA Change: V255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097493
Gene: ENSMUSG00000075203
AA Change: V255A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-48 PFAM
Pfam:7tm_1 41 290 5.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215884
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dars T C 1: 128,368,439 T386A probably benign Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Olfr1040
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1040 APN 2 86146611 missense probably benign 0.22
IGL01106:Olfr1040 APN 2 86146216 missense probably benign 0.09
IGL02193:Olfr1040 APN 2 86146715 missense probably benign 0.00
IGL02730:Olfr1040 APN 2 86146099 missense probably benign 0.05
IGL03032:Olfr1040 APN 2 86146699 missense probably damaging 1.00
IGL03165:Olfr1040 APN 2 86146068 missense possibly damaging 0.91
R0388:Olfr1040 UTSW 2 86146630 missense probably damaging 1.00
R2971:Olfr1040 UTSW 2 86146564 missense probably damaging 0.96
R4168:Olfr1040 UTSW 2 86146179 missense probably benign 0.03
R4532:Olfr1040 UTSW 2 86145930 missense possibly damaging 0.77
R5024:Olfr1040 UTSW 2 86146533 missense probably damaging 1.00
R5175:Olfr1040 UTSW 2 86145957 missense probably damaging 1.00
R5574:Olfr1040 UTSW 2 86146191 missense probably damaging 1.00
R6033:Olfr1040 UTSW 2 86146269 missense probably damaging 0.97
R6033:Olfr1040 UTSW 2 86146269 missense probably damaging 0.97
R6945:Olfr1040 UTSW 2 86146084 missense probably damaging 1.00
R6980:Olfr1040 UTSW 2 86146337 nonsense probably null
R7065:Olfr1040 UTSW 2 86146001 missense probably damaging 1.00
R8264:Olfr1040 UTSW 2 86146194 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGGAGCTCTTCATGAATATTGG -3'
(R):5'- TGTTGCTAATCATTGCTGGC -3'

Sequencing Primer
(F):5'- GGAGCTCTTCATGAATATTGGAACTG -3'
(R):5'- AATCATTGCTGGCTTCAACAC -3'
Posted On2017-10-10