Incidental Mutation 'R7061:Rhebl1'
ID548288
Institutional Source Beutler Lab
Gene Symbol Rhebl1
Ensembl Gene ENSMUSG00000023755
Gene NameRas homolog enriched in brain like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98877778-98894540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98879283 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 103 (L103P)
Ref Sequence ENSEMBL: ENSMUSP00000155149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024518] [ENSMUST00000229348] [ENSMUST00000229508] [ENSMUST00000229556] [ENSMUST00000229876]
Predicted Effect probably damaging
Transcript: ENSMUST00000024518
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024518
Gene: ENSMUSG00000023755
AA Change: L103P

DomainStartEndE-ValueType
RAS 4 170 3.16e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229348
AA Change: L107P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229508
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229556
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229876
AA Change: L103P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Rhebl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Rhebl1 APN 15 98878498 missense probably benign
IGL01530:Rhebl1 APN 15 98879486 missense probably damaging 1.00
R0570:Rhebl1 UTSW 15 98881153 missense probably benign 0.41
R2276:Rhebl1 UTSW 15 98878286 missense probably benign 0.05
R2277:Rhebl1 UTSW 15 98878286 missense probably benign 0.05
R2279:Rhebl1 UTSW 15 98878286 missense probably benign 0.05
R4908:Rhebl1 UTSW 15 98879022 missense probably damaging 1.00
R5259:Rhebl1 UTSW 15 98880583 splice site probably benign
R5827:Rhebl1 UTSW 15 98878270 missense probably damaging 1.00
R6151:Rhebl1 UTSW 15 98878279 missense probably benign 0.01
R8073:Rhebl1 UTSW 15 98878524 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGATGACAAAGCAGTTGC -3'
(R):5'- TCATCGGGGTCCATGGTTAC -3'

Sequencing Primer
(F):5'- GCTACAGTTATGCTTGTAAGATCCC -3'
(R):5'- CCATGGTTACGTTCTTGTATACTCGG -3'
Posted On2019-05-13