Incidental Mutation 'R7061:Phactr1'
ID548281
Institutional Source Beutler Lab
Gene Symbol Phactr1
Ensembl Gene ENSMUSG00000054728
Gene Namephosphatase and actin regulator 1
SynonymsRpel1, 9630030F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location42680623-43138526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43132981 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 586 (D586G)
Ref Sequence ENSEMBL: ENSMUSP00000115228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066928] [ENSMUST00000110161] [ENSMUST00000128646] [ENSMUST00000131942] [ENSMUST00000148891] [ENSMUST00000149235]
PDB Structure Structure of the Phactr1 RPEL domain and RPEL motif directed assemblies with G-actin reveal the molecular basis for actin binding cooperativity. [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-N domain bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-2 domain bound to actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-2 bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL-3 bound to G-actin [X-RAY DIFFRACTION]
Structure of the Phactr1 RPEL domain bound to G-actin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000066928
AA Change: D517G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066663
Gene: ENSMUSG00000054728
AA Change: D517G

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 219 239 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
RPEL 415 440 1.23e-6 SMART
RPEL 453 478 5.14e-9 SMART
RPEL 491 516 2.71e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110161
AA Change: D593G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105790
Gene: ENSMUSG00000054728
AA Change: D593G

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 295 315 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
RPEL 491 516 1.23e-6 SMART
RPEL 529 554 5.14e-9 SMART
RPEL 567 592 2.71e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128646
AA Change: D524G
SMART Domains Protein: ENSMUSP00000122232
Gene: ENSMUSG00000054728
AA Change: D524G

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131942
AA Change: D501G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123346
Gene: ENSMUSG00000054728
AA Change: D501G

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
RPEL 46 71 7.33e-5 SMART
low complexity region 85 103 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
low complexity region 203 223 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 372 383 N/A INTRINSIC
RPEL 399 424 1.23e-6 SMART
RPEL 437 462 5.14e-9 SMART
RPEL 475 500 2.71e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148891
AA Change: D586G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115228
Gene: ENSMUSG00000054728
AA Change: D586G

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 216 225 N/A INTRINSIC
low complexity region 288 308 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
RPEL 484 509 1.23e-6 SMART
RPEL 522 547 5.14e-9 SMART
RPEL 560 585 2.71e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000149235
AA Change: D524G
SMART Domains Protein: ENSMUSP00000115207
Gene: ENSMUSG00000054728
AA Change: D524G

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphatase and actin regulator family of proteins. This family member can bind actin and regulate the reorganization of the actin cytoskeleton. It plays a role in tubule formation and in endothelial cell survival. Polymorphisms in this gene are associated with susceptibility to myocardial infarction, coronary artery disease and cervical artery dissection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn1r60 A T 7: 5,544,311 Y263* probably null Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Phactr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Phactr1 APN 13 42956646 missense probably damaging 0.99
IGL01144:Phactr1 APN 13 43037524 missense possibly damaging 0.93
IGL02193:Phactr1 APN 13 42709700 splice site probably benign
IGL02691:Phactr1 APN 13 43077737 missense probably benign 0.38
R0028:Phactr1 UTSW 13 43057179 missense probably damaging 1.00
R0060:Phactr1 UTSW 13 42682721 nonsense probably null
R0522:Phactr1 UTSW 13 43059591 missense probably benign 0.00
R1354:Phactr1 UTSW 13 43057331 missense possibly damaging 0.91
R1382:Phactr1 UTSW 13 43132975 missense probably damaging 1.00
R1496:Phactr1 UTSW 13 43094990 missense probably damaging 0.98
R1620:Phactr1 UTSW 13 43094897 missense probably damaging 1.00
R1638:Phactr1 UTSW 13 42956671 missense probably damaging 1.00
R1679:Phactr1 UTSW 13 43057280 missense possibly damaging 0.65
R1679:Phactr1 UTSW 13 43094781 missense possibly damaging 0.94
R2055:Phactr1 UTSW 13 43077940 missense probably damaging 1.00
R2137:Phactr1 UTSW 13 43135175 missense possibly damaging 0.77
R2276:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R2279:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R3122:Phactr1 UTSW 13 43059573 missense possibly damaging 0.94
R4073:Phactr1 UTSW 13 43059769 intron probably benign
R4131:Phactr1 UTSW 13 43037477 missense probably damaging 0.99
R4237:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4238:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4239:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4240:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4507:Phactr1 UTSW 13 43096794 missense probably damaging 0.96
R4602:Phactr1 UTSW 13 43094965 missense probably benign 0.00
R4914:Phactr1 UTSW 13 43133963 missense possibly damaging 0.58
R5382:Phactr1 UTSW 13 43135219 utr 3 prime probably benign
R5882:Phactr1 UTSW 13 42709851 critical splice donor site probably null
R6253:Phactr1 UTSW 13 43094771 missense probably benign 0.06
R6451:Phactr1 UTSW 13 43132993 missense probably damaging 1.00
R6808:Phactr1 UTSW 13 43132969 missense probably damaging 1.00
R7847:Phactr1 UTSW 13 43057188 missense possibly damaging 0.96
R7912:Phactr1 UTSW 13 42709763 missense probably benign 0.08
R7937:Phactr1 UTSW 13 43077729 missense unknown
R8344:Phactr1 UTSW 13 42709821 missense possibly damaging 0.83
R8494:Phactr1 UTSW 13 43096668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGAATCCCAAAGCTGG -3'
(R):5'- AAGGATGCGGCGCCTTTAAG -3'

Sequencing Primer
(F):5'- AAAGCTGGGCACTCTGGGTTC -3'
(R):5'- CGCCTTTAAGGTGGGGC -3'
Posted On2019-05-13