Incidental Mutation 'R7061:Vmn1r60'
ID548260
Institutional Source Beutler Lab
Gene Symbol Vmn1r60
Ensembl Gene ENSMUSG00000090794
Gene Namevomeronasal 1 receptor 60
SynonymsGm7184
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7061 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location5544172-5545178 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 5544311 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 263 (Y263*)
Ref Sequence ENSEMBL: ENSMUSP00000133943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173782]
Predicted Effect probably null
Transcript: ENSMUST00000173782
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000133943
Gene: ENSMUSG00000090794
AA Change: Y263*

DomainStartEndE-ValueType
Pfam:TAS2R 8 304 4.7e-10 PFAM
Pfam:7tm_1 30 289 7.2e-6 PFAM
Pfam:V1R 41 309 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,545,065 M660T probably benign Het
Aard G A 15: 52,040,221 M13I probably benign Het
Abcb5 A C 12: 118,877,774 Y979D probably damaging Het
Adgrb1 G C 15: 74,569,881 V4L probably benign Het
Ap3b2 C T 7: 81,461,009 R1006Q unknown Het
Bpifa6 A T 2: 153,992,316 T343S probably benign Het
Celsr3 T A 9: 108,847,594 C2957* probably null Het
Chd6 G A 2: 161,025,965 Q428* probably null Het
Col5a1 C A 2: 28,025,678 C191* probably null Het
Cpox A G 16: 58,670,860 I145V possibly damaging Het
Csnk2a1 C T 2: 152,274,171 R268C probably benign Het
Dclk2 A G 3: 86,831,731 probably null Het
Dennd5a T C 7: 109,905,179 E909G probably benign Het
Depdc1a T A 3: 159,522,852 S414T possibly damaging Het
Dock5 A G 14: 67,770,254 F1502S probably damaging Het
Dopey2 G T 16: 93,762,063 A448S probably benign Het
Dsg1c C A 18: 20,277,009 N511K probably benign Het
Epc2 G T 2: 49,535,322 R108L probably damaging Het
Erp44 T A 4: 48,219,375 I147F probably benign Het
Evc T C 5: 37,319,102 T368A possibly damaging Het
Fbxo41 G T 6: 85,475,466 R738S probably benign Het
Fli1 T C 9: 32,424,222 T305A probably damaging Het
Gm4969 A T 7: 19,100,128 probably benign Het
Gm8897 T C 5: 11,419,104 V74A possibly damaging Het
Grk5 A G 19: 61,046,092 T93A probably benign Het
Grm2 A T 9: 106,651,225 N153K probably damaging Het
Helz A G 11: 107,649,177 T1007A possibly damaging Het
Helz2 A G 2: 181,240,514 L162P probably damaging Het
Hmgcr T A 13: 96,666,148 Q81L possibly damaging Het
Hnrnpu T C 1: 178,336,126 K218E unknown Het
Hydin A T 8: 110,603,288 I4885F possibly damaging Het
Ibsp A G 5: 104,309,902 probably null Het
Igfals T C 17: 24,880,307 L124P probably damaging Het
Il24 T A 1: 130,883,371 H142L possibly damaging Het
Kcnh2 A T 5: 24,331,922 H221Q probably benign Het
Man1a A G 10: 53,920,235 S454P probably damaging Het
Mfsd4b1 C T 10: 40,003,386 V172M possibly damaging Het
Mical2 T A 7: 112,346,801 I763K probably benign Het
Mybpc3 A G 2: 91,125,404 I594M possibly damaging Het
Neo1 T A 9: 58,990,441 R77S possibly damaging Het
Nlrp6 A G 7: 140,922,867 I265M probably benign Het
Olfr1350 A G 7: 6,570,783 Y264C probably damaging Het
Olfr669 T C 7: 104,938,676 L50P probably damaging Het
Olfr877 T A 9: 37,855,646 V276D possibly damaging Het
Pcdhgb5 C A 18: 37,731,923 P257Q probably benign Het
Phactr1 A G 13: 43,132,981 D586G probably damaging Het
Pkn3 T A 2: 30,083,536 probably null Het
Prob1 A T 18: 35,654,500 S234T probably benign Het
Rab14 A T 2: 35,183,417 L131* probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rhebl1 A G 15: 98,879,283 L103P probably damaging Het
Rnf10 G T 5: 115,257,090 F146L probably damaging Het
Rrbp1 T C 2: 143,989,167 K360R possibly damaging Het
Slc6a9 C T 4: 117,868,064 T575I probably benign Het
Smo A G 6: 29,760,230 H776R probably damaging Het
Tns2 A G 15: 102,104,479 M1V probably null Het
Ttn C A 2: 76,894,692 probably benign Het
Ugt3a1 A T 15: 9,306,154 M130L probably benign Het
Urb2 C T 8: 124,028,297 H248Y probably benign Het
Vit A T 17: 78,625,156 N564I probably damaging Het
Vmn2r16 A T 5: 109,363,754 Y609F probably damaging Het
Xpo7 T C 14: 70,671,072 I876V probably benign Het
Zfp442 A G 2: 150,408,017 I655T probably benign Het
Zfp574 T A 7: 25,080,197 C215S possibly damaging Het
Zfp608 T C 18: 54,987,997 T173A probably benign Het
Zfp69 A T 4: 120,931,401 V239D possibly damaging Het
Other mutations in Vmn1r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Vmn1r60 APN 7 5544229 missense probably benign 0.05
IGL01892:Vmn1r60 APN 7 5544310 missense probably benign 0.02
IGL02427:Vmn1r60 APN 7 5544781 missense probably damaging 1.00
IGL03071:Vmn1r60 APN 7 5544369 missense probably damaging 0.97
R0200:Vmn1r60 UTSW 7 5544380 missense probably benign
R0457:Vmn1r60 UTSW 7 5545119 start gained probably benign
R1175:Vmn1r60 UTSW 7 5544622 missense probably benign 0.01
R1199:Vmn1r60 UTSW 7 5544972 missense probably damaging 0.99
R1529:Vmn1r60 UTSW 7 5544903 missense probably benign 0.00
R1859:Vmn1r60 UTSW 7 5544550 missense possibly damaging 0.64
R2033:Vmn1r60 UTSW 7 5544820 missense probably benign
R2405:Vmn1r60 UTSW 7 5544913 missense probably benign
R3408:Vmn1r60 UTSW 7 5545149 utr 5 prime probably null
R3771:Vmn1r60 UTSW 7 5544711 missense possibly damaging 0.76
R3773:Vmn1r60 UTSW 7 5544711 missense possibly damaging 0.76
R3852:Vmn1r60 UTSW 7 5545027 missense possibly damaging 0.79
R4236:Vmn1r60 UTSW 7 5544804 missense probably benign 0.06
R4331:Vmn1r60 UTSW 7 5544365 nonsense probably null
R4439:Vmn1r60 UTSW 7 5544489 missense probably damaging 1.00
R5099:Vmn1r60 UTSW 7 5544817 missense probably damaging 0.98
R5325:Vmn1r60 UTSW 7 5544202 missense probably benign
R5415:Vmn1r60 UTSW 7 5544417 missense probably benign 0.38
R5818:Vmn1r60 UTSW 7 5545099 start codon destroyed probably benign 0.04
R6375:Vmn1r60 UTSW 7 5545018 missense probably damaging 0.96
R6378:Vmn1r60 UTSW 7 5544783 missense probably damaging 0.99
R6478:Vmn1r60 UTSW 7 5544865 missense probably damaging 1.00
R6572:Vmn1r60 UTSW 7 5544600 missense probably benign 0.40
R6586:Vmn1r60 UTSW 7 5544447 missense probably benign 0.00
R7506:Vmn1r60 UTSW 7 5544862 missense
R7589:Vmn1r60 UTSW 7 5544689 missense
Predicted Primers PCR Primer
(F):5'- GGCATCAAGATGAGAATTTTCAGG -3'
(R):5'- GACCAGTGTCTCCATGGTGATTC -3'

Sequencing Primer
(F):5'- CAAGATGAGAATTTTCAGGGTTTGG -3'
(R):5'- GTGATTCACCTAAACAGACACCAC -3'
Posted On2019-05-13