Incidental Mutation 'R7121:Pcnt'
ID552021
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7121 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76427927 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 401 (V401A)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect probably benign
Transcript: ENSMUST00000001179
AA Change: V401A

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: V401A

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000217838
AA Change: V401A

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Akap10 A G 11: 61,886,698 probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Chmp5 A T 4: 40,952,217 probably null Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Fn1 A C 1: 71,600,538 probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Neto2 T C 8: 85,670,391 probably null Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Odf2l G A 3: 145,139,820 V363I possibly damaging Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr1458 T A 19: 13,103,173 I44F probably benign Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Sgca G A 11: 94,969,547 P255S possibly damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Taar2 T G 10: 23,940,827 S88R probably damaging Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Ubr1 G A 2: 120,875,498 L1495F probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 splice site probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
R7538:Pcnt UTSW 10 76399939 missense probably benign
R7575:Pcnt UTSW 10 76389252 missense probably benign 0.32
R7662:Pcnt UTSW 10 76387522 missense probably benign 0.27
R7685:Pcnt UTSW 10 76422808 missense probably benign 0.14
R7764:Pcnt UTSW 10 76354248 missense probably benign 0.33
R7802:Pcnt UTSW 10 76375303 splice site probably null
R8432:Pcnt UTSW 10 76420205 missense probably damaging 1.00
R8439:Pcnt UTSW 10 76420205 missense probably damaging 1.00
Z1176:Pcnt UTSW 10 76382157 nonsense probably null
Z1177:Pcnt UTSW 10 76399968 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGCTTAGCCAGTACCATAACA -3'
(R):5'- CGAGAGCTGCTGGGGTACTT -3'

Sequencing Primer
(F):5'- ACCTTTATTACCAGGCCTAGGGAG -3'
(R):5'- TACATGCTTCTCCCACTAAAGG -3'
Posted On2019-05-15