Incidental Mutation 'R0599:Stx8'
ID 55239
Institutional Source Beutler Lab
Gene Symbol Stx8
Ensembl Gene ENSMUSG00000020903
Gene Name syntaxin 8
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0599 (G1)
Quality Score 220
Status Validated
Chromosome 11
Chromosomal Location 67966193-68207148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68109362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 209 (R209S)
Ref Sequence ENSEMBL: ENSMUSP00000021285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021285]
AlphaFold O88983
Predicted Effect probably null
Transcript: ENSMUST00000021285
AA Change: R209S

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021285
Gene: ENSMUSG00000020903
AA Change: R209S

low complexity region 47 63 N/A INTRINSIC
t_SNARE 140 207 2.77e-13 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129992
Meta Mutation Damage Score 0.1620 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the syntaxin family. The encoded protein is involved in protein trafficking from early to late endosomes via vesicle fusion and exocytosis. A related pseudogene has been identified on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in platelet dense granule secretion, aggregation, and thrombus stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Stx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Stx8 APN 11 67969772 missense probably damaging 1.00
IGL02860:Stx8 APN 11 67984565 missense probably damaging 1.00
IGL03084:Stx8 APN 11 68020956 nonsense probably null
R0574:Stx8 UTSW 11 67973252 missense probably damaging 0.99
R1696:Stx8 UTSW 11 68011422 missense probably damaging 1.00
R1816:Stx8 UTSW 11 68011326 missense possibly damaging 0.95
R1928:Stx8 UTSW 11 68109280 missense probably damaging 0.98
R2352:Stx8 UTSW 11 67973251 missense probably benign 0.02
R4822:Stx8 UTSW 11 67973273 missense possibly damaging 0.90
R5485:Stx8 UTSW 11 68020966 missense probably benign 0.00
R7673:Stx8 UTSW 11 67984639 missense probably benign 0.29
R7722:Stx8 UTSW 11 68203718 missense probably damaging 1.00
R7832:Stx8 UTSW 11 68109280 missense probably damaging 1.00
R7852:Stx8 UTSW 11 67969785 missense probably damaging 0.99
R8343:Stx8 UTSW 11 68020988 missense probably benign 0.14
R9048:Stx8 UTSW 11 68011385 missense probably damaging 1.00
R9171:Stx8 UTSW 11 67984645 missense possibly damaging 0.59
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcccctacctaatgagccac -3'
Posted On 2013-07-11