Mutagenetix > Incidental Mutations

Incidental Mutation 'R0599:Stx8'

55239

Institutional Source

Beutler Lab

Gene Symbol

Stx8

Ensembl Gene

ENSMUSG00000020903

Gene Name

syntaxin 8

Synonyms

MMRRC Submission

038788-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0599 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

67966193-68207148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68109362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 209 (R209S)

Ref Sequence

ENSEMBL: ENSMUSP00000021285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021285]

AlphaFold

O88983

Predicted Effect

probably null
Transcript: ENSMUST00000021285
AA Change: R209S

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000021285
Gene: ENSMUSG00000020903
AA Change: R209S

Domain	Start	End	E-Value	Type
low complexity region	47	63	N/A	INTRINSIC
t_SNARE	140	207	2.77e-13	SMART
transmembrane domain	211	233	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129992

Meta Mutation Damage Score

0.1620

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the syntaxin family. The encoded protein is involved in protein trafficking from early to late endosomes via vesicle fusion and exocytosis. A related pseudogene has been identified on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in platelet dense granule secretion, aggregation, and thrombus stability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,552,245	L978P	probably damaging	Het
Abcb1a	C	T	5: 8,698,539	T290M	probably benign	Het
Abcd3	A	T	3: 121,765,093	F585I	probably damaging	Het
Acan	A	G	7: 79,111,290		probably benign	Het
Anxa6	T	C	11: 54,979,466	D667G	possibly damaging	Het
Ap3m2	G	T	8: 22,793,112	A208D	possibly damaging	Het
Arhgap17	A	T	7: 123,303,790		probably benign	Het
Bptf	A	G	11: 107,068,382	V1838A	probably damaging	Het
Brip1	T	A	11: 86,152,737	M334L	probably benign	Het
Btbd10	C	T	7: 113,335,309		probably benign	Het
Btbd11	G	A	10: 85,658,336	G1106D	probably damaging	Het
Cdh7	C	A	1: 110,052,966	T208K	probably damaging	Het
Cnga4	A	G	7: 105,405,818	Y100C	probably damaging	Het
Dnah10	G	A	5: 124,800,953	V2644M	probably damaging	Het
Dnah9	T	C	11: 65,965,689	D2882G	probably damaging	Het
Eapp	T	A	12: 54,685,962	K117M	probably damaging	Het
Eml3	T	C	19: 8,939,063	V673A	probably benign	Het
Ephb4	G	A	5: 137,369,855	C754Y	probably damaging	Het
Eps8l1	A	G	7: 4,477,957	D33G	possibly damaging	Het
Farsa	A	G	8: 84,867,583	K321E	probably damaging	Het
Fry	G	A	5: 150,437,159	R2090Q	probably damaging	Het
Gm10283	A	G	8: 60,501,224		probably benign	Het
Grm4	A	G	17: 27,431,490	I844T	probably benign	Het
Gtf2h3	A	G	5: 124,588,628	D124G	probably benign	Het
Gulo	A	T	14: 65,990,441	D347E	probably damaging	Het
Hmcn1	A	G	1: 150,609,801	F4350S	possibly damaging	Het
Hspg2	A	G	4: 137,512,401	D473G	probably damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Insrr	A	G	3: 87,813,133	E1026G	probably damaging	Het
Itga2	A	T	13: 114,856,650		probably benign	Het
Kdm1b	A	T	13: 47,058,810	D190V	possibly damaging	Het
Lima1	A	T	15: 99,802,159	N146K	probably damaging	Het
Mettl7a3	A	T	15: 100,335,383	N152Y	possibly damaging	Het
Mnt	G	T	11: 74,842,296	V85L	probably benign	Het
Mon2	T	A	10: 123,026,065		probably benign	Het
Mtf1	T	C	4: 124,820,201		probably benign	Het
Mylk4	T	C	13: 32,712,754		probably null	Het
Myo18b	A	C	5: 112,865,750	L780R	probably damaging	Het
Myo1e	A	G	9: 70,376,660		probably benign	Het
Obscn	A	G	11: 59,073,696	S705P	probably damaging	Het
Ocrl	A	T	X: 47,936,086		probably benign	Het
Olfr1260	T	C	2: 89,978,201	F141S	probably benign	Het
Olfr394	A	T	11: 73,887,904	M156K	probably benign	Het
Olfr599	A	G	7: 103,338,186	N44S	probably damaging	Het
Olfr639	A	T	7: 104,012,188	C171*	probably null	Het
Otof	T	A	5: 30,370,705	K1931N	probably damaging	Het
Plcxd3	A	G	15: 4,516,867	S118G	probably damaging	Het
Plcz1	T	A	6: 140,028,542	Q58L	probably benign	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Rassf4	T	C	6: 116,645,936	E38G	probably damaging	Het
Ros1	A	T	10: 52,123,300	Y1164N	probably damaging	Het
Rpgrip1l	A	G	8: 91,305,000	I83T	probably damaging	Het
Scn9a	T	G	2: 66,526,799	K1053Q	probably damaging	Het
Sgsm1	G	T	5: 113,245,028	Q1087K	probably damaging	Het
Slc16a10	T	C	10: 40,141,918	D40G	probably benign	Het
Slc27a6	A	G	18: 58,556,813	D117G	probably damaging	Het
Slc2a9	T	A	5: 38,480,144		probably benign	Het
Slc4a1	A	G	11: 102,357,915		probably benign	Het
Smarca1	T	A	X: 47,823,426	Q982L	probably benign	Het
Sp100	T	A	1: 85,681,110	I320N	possibly damaging	Het
Sulf2	T	C	2: 166,083,879	T453A	possibly damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tenm2	T	A	11: 36,024,780	I1976F	possibly damaging	Het
Tenm3	G	A	8: 48,277,710	S1341L	probably damaging	Het
Tmem130	C	T	5: 144,737,809	V369M	probably damaging	Het
Tmem200c	A	G	17: 68,840,511	K30E	probably damaging	Het
Tmem225	A	G	9: 40,149,747	I117V	possibly damaging	Het
Top2a	A	G	11: 99,001,417	I1073T	probably damaging	Het
Trps1	A	C	15: 50,831,860	Y296*	probably null	Het
Tubg1	T	C	11: 101,125,336	M377T	probably benign	Het
Vmn1r35	G	A	6: 66,679,513	H58Y	probably benign	Het
Vmn1r56	G	A	7: 5,196,430	H63Y	probably benign	Het
Vmn1r75	T	C	7: 11,881,262		probably null	Het
Vnn3	T	C	10: 23,865,705	S303P	possibly damaging	Het
Wdr49	C	T	3: 75,431,076		probably null	Het
Wdr49	T	C	3: 75,449,890		probably null	Het
Zcchc6	A	G	13: 59,809,487	V7A	probably damaging	Het
Zzef1	T	C	11: 72,913,178	L2582P	probably damaging	Het

Other mutations in Stx8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02679:Stx8	APN	11	67969772	missense	probably damaging	1.00
IGL02860:Stx8	APN	11	67984565	missense	probably damaging	1.00
IGL03084:Stx8	APN	11	68020956	nonsense	probably null
R0574:Stx8	UTSW	11	67973252	missense	probably damaging	0.99
R1696:Stx8	UTSW	11	68011422	missense	probably damaging	1.00
R1816:Stx8	UTSW	11	68011326	missense	possibly damaging	0.95
R1928:Stx8	UTSW	11	68109280	missense	probably damaging	0.98
R2352:Stx8	UTSW	11	67973251	missense	probably benign	0.02
R4822:Stx8	UTSW	11	67973273	missense	possibly damaging	0.90
R5485:Stx8	UTSW	11	68020966	missense	probably benign	0.00
R7673:Stx8	UTSW	11	67984639	missense	probably benign	0.29
R7722:Stx8	UTSW	11	68203718	missense	probably damaging	1.00
R7832:Stx8	UTSW	11	68109280	missense	probably damaging	1.00
R7852:Stx8	UTSW	11	67969785	missense	probably damaging	0.99
R8343:Stx8	UTSW	11	68020988	missense	probably benign	0.14
R9048:Stx8	UTSW	11	68011385	missense	probably damaging	1.00
R9171:Stx8	UTSW	11	67984645	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- TGTGGCAAGTGCCCCTACCTAATG -3'
(R):5'- GGGTGATGGTTACACTCTCCGAAC -3'

Sequencing Primer
(F):5'- gcccctacctaatgagccac -3'
(R):5'- GATGGTTACACTCTCCGAACTTTAG -3'

Posted On

2013-07-11