Incidental Mutation 'R0599:Mtf1'
ID 55200
Institutional Source Beutler Lab
Gene Symbol Mtf1
Ensembl Gene ENSMUSG00000028890
Gene Name metal response element binding transcription factor 1
Synonyms Thyls, metalloregulatory transcription factor, MTF-1, metal response element-binding transcription factor 1
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 124802104-124849800 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 124820201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000106193] [ENSMUST00000138807]
AlphaFold Q07243
Predicted Effect probably benign
Transcript: ENSMUST00000030723
SMART Domains Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890

ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106193
SMART Domains Protein: ENSMUSP00000101799
Gene: ENSMUSG00000028890

ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122577
Predicted Effect probably benign
Transcript: ENSMUST00000138807
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation show impaired hepatocyte development followed by embryonic liver degeneration, generalized edema, and death at ~14 days of gestation. Mutant embryonic fibroblasts show increased susceptibility to the cytotoxiceffects of cadmium and hydrogen peroxide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem200c A G 17: 68,840,511 K30E probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Mtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Mtf1 APN 4 124804927 missense probably damaging 0.99
IGL02491:Mtf1 APN 4 124838579 missense probably benign 0.00
IGL02493:Mtf1 APN 4 124821319 missense probably damaging 1.00
IGL02644:Mtf1 APN 4 124820235 missense probably damaging 1.00
IGL02661:Mtf1 APN 4 124825109 missense probably damaging 0.98
IGL03018:Mtf1 APN 4 124838663 missense probably benign 0.44
LCD18:Mtf1 UTSW 4 124829316 intron probably benign
R0443:Mtf1 UTSW 4 124824282 unclassified probably benign
R1103:Mtf1 UTSW 4 124838468 missense probably benign 0.28
R2496:Mtf1 UTSW 4 124838904 missense probably benign 0.01
R4258:Mtf1 UTSW 4 124838783 missense probably benign 0.00
R4818:Mtf1 UTSW 4 124804712 start codon destroyed probably null 1.00
R5085:Mtf1 UTSW 4 124821308 missense probably damaging 1.00
R5248:Mtf1 UTSW 4 124820427 missense probably damaging 1.00
R5368:Mtf1 UTSW 4 124825079 missense probably damaging 0.98
R6368:Mtf1 UTSW 4 124824352 missense probably damaging 1.00
R6768:Mtf1 UTSW 4 124837785 missense probably benign 0.01
R7417:Mtf1 UTSW 4 124825181 missense probably null 0.00
R7559:Mtf1 UTSW 4 124820206 missense probably damaging 1.00
R7730:Mtf1 UTSW 4 124838619 missense possibly damaging 0.49
R7739:Mtf1 UTSW 4 124824288 missense probably damaging 1.00
R8234:Mtf1 UTSW 4 124844246 missense probably benign 0.44
R8878:Mtf1 UTSW 4 124821230 nonsense probably null
R8954:Mtf1 UTSW 4 124804856 missense probably damaging 0.96
R9138:Mtf1 UTSW 4 124838717 nonsense probably null
R9287:Mtf1 UTSW 4 124831141 missense probably damaging 1.00
X0018:Mtf1 UTSW 4 124838847 missense possibly damaging 0.62
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cctcagcactgcatgaaaac -3'
Posted On 2013-07-11