Mutagenetix > Incidental Mutations

Incidental Mutation 'R0599:Mtf1'

55200

Institutional Source

Beutler Lab

Gene Symbol

Mtf1

Ensembl Gene

ENSMUSG00000028890

Gene Name

metal response element binding transcription factor 1

Synonyms

Thyls, metalloregulatory transcription factor, MTF-1, metal response element-binding transcription factor 1

MMRRC Submission

038788-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0599 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124802104-124849800 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 124820201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000106193] [ENSMUST00000138807]

AlphaFold

Q07243

Predicted Effect

probably benign
Transcript: ENSMUST00000030723

SMART Domains

Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890

Domain	Start	End	E-Value	Type
ZnF_C2H2	139	163	1.22e-4	SMART
ZnF_C2H2	169	193	6.42e-4	SMART
ZnF_C2H2	199	223	2.4e-3	SMART
ZnF_C2H2	228	252	2.57e-3	SMART
ZnF_C2H2	258	282	2.57e-3	SMART
ZnF_C2H2	288	312	7.37e-4	SMART
low complexity region	429	456	N/A	INTRINSIC
low complexity region	500	526	N/A	INTRINSIC
low complexity region	545	558	N/A	INTRINSIC
low complexity region	628	638	N/A	INTRINSIC
low complexity region	656	669	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106193

SMART Domains

Protein: ENSMUSP00000101799
Gene: ENSMUSG00000028890

Domain	Start	End	E-Value	Type
ZnF_C2H2	139	163	1.22e-4	SMART
ZnF_C2H2	169	193	6.42e-4	SMART
ZnF_C2H2	199	223	2.4e-3	SMART
ZnF_C2H2	228	252	2.57e-3	SMART
ZnF_C2H2	258	282	2.57e-3	SMART
ZnF_C2H2	288	312	7.37e-4	SMART
low complexity region	429	456	N/A	INTRINSIC
low complexity region	500	526	N/A	INTRINSIC
low complexity region	545	558	N/A	INTRINSIC
low complexity region	628	638	N/A	INTRINSIC
low complexity region	656	669	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122577

Predicted Effect

probably benign
Transcript: ENSMUST00000138807

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation show impaired hepatocyte development followed by embryonic liver degeneration, generalized edema, and death at ~14 days of gestation. Mutant embryonic fibroblasts show increased susceptibility to the cytotoxiceffects of cadmium and hydrogen peroxide. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,552,245	L978P	probably damaging	Het
Abcb1a	C	T	5: 8,698,539	T290M	probably benign	Het
Abcd3	A	T	3: 121,765,093	F585I	probably damaging	Het
Acan	A	G	7: 79,111,290		probably benign	Het
Anxa6	T	C	11: 54,979,466	D667G	possibly damaging	Het
Ap3m2	G	T	8: 22,793,112	A208D	possibly damaging	Het
Arhgap17	A	T	7: 123,303,790		probably benign	Het
Bptf	A	G	11: 107,068,382	V1838A	probably damaging	Het
Brip1	T	A	11: 86,152,737	M334L	probably benign	Het
Btbd10	C	T	7: 113,335,309		probably benign	Het
Btbd11	G	A	10: 85,658,336	G1106D	probably damaging	Het
Cdh7	C	A	1: 110,052,966	T208K	probably damaging	Het
Cnga4	A	G	7: 105,405,818	Y100C	probably damaging	Het
Dnah10	G	A	5: 124,800,953	V2644M	probably damaging	Het
Dnah9	T	C	11: 65,965,689	D2882G	probably damaging	Het
Eapp	T	A	12: 54,685,962	K117M	probably damaging	Het
Eml3	T	C	19: 8,939,063	V673A	probably benign	Het
Ephb4	G	A	5: 137,369,855	C754Y	probably damaging	Het
Eps8l1	A	G	7: 4,477,957	D33G	possibly damaging	Het
Farsa	A	G	8: 84,867,583	K321E	probably damaging	Het
Fry	G	A	5: 150,437,159	R2090Q	probably damaging	Het
Gm10283	A	G	8: 60,501,224		probably benign	Het
Grm4	A	G	17: 27,431,490	I844T	probably benign	Het
Gtf2h3	A	G	5: 124,588,628	D124G	probably benign	Het
Gulo	A	T	14: 65,990,441	D347E	probably damaging	Het
Hmcn1	A	G	1: 150,609,801	F4350S	possibly damaging	Het
Hspg2	A	G	4: 137,512,401	D473G	probably damaging	Het
Il17ra	T	A	6: 120,481,505	I539N	probably damaging	Het
Insrr	A	G	3: 87,813,133	E1026G	probably damaging	Het
Itga2	A	T	13: 114,856,650		probably benign	Het
Kdm1b	A	T	13: 47,058,810	D190V	possibly damaging	Het
Lima1	A	T	15: 99,802,159	N146K	probably damaging	Het
Mettl7a3	A	T	15: 100,335,383	N152Y	possibly damaging	Het
Mnt	G	T	11: 74,842,296	V85L	probably benign	Het
Mon2	T	A	10: 123,026,065		probably benign	Het
Mylk4	T	C	13: 32,712,754		probably null	Het
Myo18b	A	C	5: 112,865,750	L780R	probably damaging	Het
Myo1e	A	G	9: 70,376,660		probably benign	Het
Obscn	A	G	11: 59,073,696	S705P	probably damaging	Het
Ocrl	A	T	X: 47,936,086		probably benign	Het
Olfr1260	T	C	2: 89,978,201	F141S	probably benign	Het
Olfr394	A	T	11: 73,887,904	M156K	probably benign	Het
Olfr599	A	G	7: 103,338,186	N44S	probably damaging	Het
Olfr639	A	T	7: 104,012,188	C171*	probably null	Het
Otof	T	A	5: 30,370,705	K1931N	probably damaging	Het
Plcxd3	A	G	15: 4,516,867	S118G	probably damaging	Het
Plcz1	T	A	6: 140,028,542	Q58L	probably benign	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Rassf4	T	C	6: 116,645,936	E38G	probably damaging	Het
Ros1	A	T	10: 52,123,300	Y1164N	probably damaging	Het
Rpgrip1l	A	G	8: 91,305,000	I83T	probably damaging	Het
Scn9a	T	G	2: 66,526,799	K1053Q	probably damaging	Het
Sgsm1	G	T	5: 113,245,028	Q1087K	probably damaging	Het
Slc16a10	T	C	10: 40,141,918	D40G	probably benign	Het
Slc27a6	A	G	18: 58,556,813	D117G	probably damaging	Het
Slc2a9	T	A	5: 38,480,144		probably benign	Het
Slc4a1	A	G	11: 102,357,915		probably benign	Het
Smarca1	T	A	X: 47,823,426	Q982L	probably benign	Het
Sp100	T	A	1: 85,681,110	I320N	possibly damaging	Het
Stx8	A	T	11: 68,109,362	R209S	probably null	Het
Sulf2	T	C	2: 166,083,879	T453A	possibly damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tenm2	T	A	11: 36,024,780	I1976F	possibly damaging	Het
Tenm3	G	A	8: 48,277,710	S1341L	probably damaging	Het
Tmem130	C	T	5: 144,737,809	V369M	probably damaging	Het
Tmem200c	A	G	17: 68,840,511	K30E	probably damaging	Het
Tmem225	A	G	9: 40,149,747	I117V	possibly damaging	Het
Top2a	A	G	11: 99,001,417	I1073T	probably damaging	Het
Trps1	A	C	15: 50,831,860	Y296*	probably null	Het
Tubg1	T	C	11: 101,125,336	M377T	probably benign	Het
Vmn1r35	G	A	6: 66,679,513	H58Y	probably benign	Het
Vmn1r56	G	A	7: 5,196,430	H63Y	probably benign	Het
Vmn1r75	T	C	7: 11,881,262		probably null	Het
Vnn3	T	C	10: 23,865,705	S303P	possibly damaging	Het
Wdr49	C	T	3: 75,431,076		probably null	Het
Wdr49	T	C	3: 75,449,890		probably null	Het
Zcchc6	A	G	13: 59,809,487	V7A	probably damaging	Het
Zzef1	T	C	11: 72,913,178	L2582P	probably damaging	Het

Other mutations in Mtf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01902:Mtf1	APN	4	124804927	missense	probably damaging	0.99
IGL02491:Mtf1	APN	4	124838579	missense	probably benign	0.00
IGL02493:Mtf1	APN	4	124821319	missense	probably damaging	1.00
IGL02644:Mtf1	APN	4	124820235	missense	probably damaging	1.00
IGL02661:Mtf1	APN	4	124825109	missense	probably damaging	0.98
IGL03018:Mtf1	APN	4	124838663	missense	probably benign	0.44
LCD18:Mtf1	UTSW	4	124829316	intron	probably benign
R0443:Mtf1	UTSW	4	124824282	unclassified	probably benign
R1103:Mtf1	UTSW	4	124838468	missense	probably benign	0.28
R2496:Mtf1	UTSW	4	124838904	missense	probably benign	0.01
R4258:Mtf1	UTSW	4	124838783	missense	probably benign	0.00
R4818:Mtf1	UTSW	4	124804712	start codon destroyed	probably null	1.00
R5085:Mtf1	UTSW	4	124821308	missense	probably damaging	1.00
R5248:Mtf1	UTSW	4	124820427	missense	probably damaging	1.00
R5368:Mtf1	UTSW	4	124825079	missense	probably damaging	0.98
R6368:Mtf1	UTSW	4	124824352	missense	probably damaging	1.00
R6768:Mtf1	UTSW	4	124837785	missense	probably benign	0.01
R7417:Mtf1	UTSW	4	124825181	missense	probably null	0.00
R7559:Mtf1	UTSW	4	124820206	missense	probably damaging	1.00
R7730:Mtf1	UTSW	4	124838619	missense	possibly damaging	0.49
R7739:Mtf1	UTSW	4	124824288	missense	probably damaging	1.00
R8234:Mtf1	UTSW	4	124844246	missense	probably benign	0.44
R8878:Mtf1	UTSW	4	124821230	nonsense	probably null
R8954:Mtf1	UTSW	4	124804856	missense	probably damaging	0.96
R9138:Mtf1	UTSW	4	124838717	nonsense	probably null
R9287:Mtf1	UTSW	4	124831141	missense	probably damaging	1.00
X0018:Mtf1	UTSW	4	124838847	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GGTGCCATCCCTCCAGCTTTAATAC -3'
(R):5'- GCACGTCACACTCAAATGGCTTC -3'

Sequencing Primer
(F):5'- cctcagcactgcatgaaaac -3'
(R):5'- CAAATGGCTTCTCCTTTGTGTG -3'

Posted On

2013-07-11