Incidental Mutation 'R0599:Tmem200c'
ID 55257
Institutional Source Beutler Lab
Gene Symbol Tmem200c
Ensembl Gene ENSMUSG00000095407
Gene Name transmembrane protein 200C
Synonyms Gm6338
MMRRC Submission 038788-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 68837136-68843138 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68840511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 30 (K30E)
Ref Sequence ENSEMBL: ENSMUSP00000137246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178545]
AlphaFold J3QK46
Predicted Effect probably damaging
Transcript: ENSMUST00000178545
AA Change: K30E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137246
Gene: ENSMUSG00000095407
AA Change: K30E

DomainStartEndE-ValueType
Pfam:DUF2371 14 209 4.1e-65 PFAM
SCOP:d1gkub1 227 258 2e-3 SMART
low complexity region 272 291 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
low complexity region 382 398 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
Meta Mutation Damage Score 0.1845 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,245 L978P probably damaging Het
Abcb1a C T 5: 8,698,539 T290M probably benign Het
Abcd3 A T 3: 121,765,093 F585I probably damaging Het
Acan A G 7: 79,111,290 probably benign Het
Anxa6 T C 11: 54,979,466 D667G possibly damaging Het
Ap3m2 G T 8: 22,793,112 A208D possibly damaging Het
Arhgap17 A T 7: 123,303,790 probably benign Het
Bptf A G 11: 107,068,382 V1838A probably damaging Het
Brip1 T A 11: 86,152,737 M334L probably benign Het
Btbd10 C T 7: 113,335,309 probably benign Het
Btbd11 G A 10: 85,658,336 G1106D probably damaging Het
Cdh7 C A 1: 110,052,966 T208K probably damaging Het
Cnga4 A G 7: 105,405,818 Y100C probably damaging Het
Dnah10 G A 5: 124,800,953 V2644M probably damaging Het
Dnah9 T C 11: 65,965,689 D2882G probably damaging Het
Eapp T A 12: 54,685,962 K117M probably damaging Het
Eml3 T C 19: 8,939,063 V673A probably benign Het
Ephb4 G A 5: 137,369,855 C754Y probably damaging Het
Eps8l1 A G 7: 4,477,957 D33G possibly damaging Het
Farsa A G 8: 84,867,583 K321E probably damaging Het
Fry G A 5: 150,437,159 R2090Q probably damaging Het
Gm10283 A G 8: 60,501,224 probably benign Het
Grm4 A G 17: 27,431,490 I844T probably benign Het
Gtf2h3 A G 5: 124,588,628 D124G probably benign Het
Gulo A T 14: 65,990,441 D347E probably damaging Het
Hmcn1 A G 1: 150,609,801 F4350S possibly damaging Het
Hspg2 A G 4: 137,512,401 D473G probably damaging Het
Il17ra T A 6: 120,481,505 I539N probably damaging Het
Insrr A G 3: 87,813,133 E1026G probably damaging Het
Itga2 A T 13: 114,856,650 probably benign Het
Kdm1b A T 13: 47,058,810 D190V possibly damaging Het
Lima1 A T 15: 99,802,159 N146K probably damaging Het
Mettl7a3 A T 15: 100,335,383 N152Y possibly damaging Het
Mnt G T 11: 74,842,296 V85L probably benign Het
Mon2 T A 10: 123,026,065 probably benign Het
Mtf1 T C 4: 124,820,201 probably benign Het
Mylk4 T C 13: 32,712,754 probably null Het
Myo18b A C 5: 112,865,750 L780R probably damaging Het
Myo1e A G 9: 70,376,660 probably benign Het
Obscn A G 11: 59,073,696 S705P probably damaging Het
Ocrl A T X: 47,936,086 probably benign Het
Olfr1260 T C 2: 89,978,201 F141S probably benign Het
Olfr394 A T 11: 73,887,904 M156K probably benign Het
Olfr599 A G 7: 103,338,186 N44S probably damaging Het
Olfr639 A T 7: 104,012,188 C171* probably null Het
Otof T A 5: 30,370,705 K1931N probably damaging Het
Plcxd3 A G 15: 4,516,867 S118G probably damaging Het
Plcz1 T A 6: 140,028,542 Q58L probably benign Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Rassf4 T C 6: 116,645,936 E38G probably damaging Het
Ros1 A T 10: 52,123,300 Y1164N probably damaging Het
Rpgrip1l A G 8: 91,305,000 I83T probably damaging Het
Scn9a T G 2: 66,526,799 K1053Q probably damaging Het
Sgsm1 G T 5: 113,245,028 Q1087K probably damaging Het
Slc16a10 T C 10: 40,141,918 D40G probably benign Het
Slc27a6 A G 18: 58,556,813 D117G probably damaging Het
Slc2a9 T A 5: 38,480,144 probably benign Het
Slc4a1 A G 11: 102,357,915 probably benign Het
Smarca1 T A X: 47,823,426 Q982L probably benign Het
Sp100 T A 1: 85,681,110 I320N possibly damaging Het
Stx8 A T 11: 68,109,362 R209S probably null Het
Sulf2 T C 2: 166,083,879 T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tenm2 T A 11: 36,024,780 I1976F possibly damaging Het
Tenm3 G A 8: 48,277,710 S1341L probably damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tmem225 A G 9: 40,149,747 I117V possibly damaging Het
Top2a A G 11: 99,001,417 I1073T probably damaging Het
Trps1 A C 15: 50,831,860 Y296* probably null Het
Tubg1 T C 11: 101,125,336 M377T probably benign Het
Vmn1r35 G A 6: 66,679,513 H58Y probably benign Het
Vmn1r56 G A 7: 5,196,430 H63Y probably benign Het
Vmn1r75 T C 7: 11,881,262 probably null Het
Vnn3 T C 10: 23,865,705 S303P possibly damaging Het
Wdr49 C T 3: 75,431,076 probably null Het
Wdr49 T C 3: 75,449,890 probably null Het
Zcchc6 A G 13: 59,809,487 V7A probably damaging Het
Zzef1 T C 11: 72,913,178 L2582P probably damaging Het
Other mutations in Tmem200c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0360:Tmem200c UTSW 17 68840548 missense probably damaging 1.00
R0364:Tmem200c UTSW 17 68840548 missense probably damaging 1.00
R0711:Tmem200c UTSW 17 68842254 missense probably damaging 1.00
R1311:Tmem200c UTSW 17 68840763 missense probably damaging 0.98
R1852:Tmem200c UTSW 17 68840617 missense probably damaging 1.00
R1951:Tmem200c UTSW 17 68840988 missense probably damaging 1.00
R1954:Tmem200c UTSW 17 68840961 missense probably damaging 1.00
R1955:Tmem200c UTSW 17 68840961 missense probably damaging 1.00
R2144:Tmem200c UTSW 17 68842249 missense possibly damaging 0.49
R2189:Tmem200c UTSW 17 68840686 missense probably damaging 0.98
R2397:Tmem200c UTSW 17 68840947 missense probably damaging 1.00
R4546:Tmem200c UTSW 17 68842171 missense probably benign
R4715:Tmem200c UTSW 17 68840470 missense probably damaging 1.00
R4752:Tmem200c UTSW 17 68842240 missense probably benign 0.05
R5214:Tmem200c UTSW 17 68841127 missense probably damaging 1.00
R5751:Tmem200c UTSW 17 68840552 missense probably damaging 1.00
R5827:Tmem200c UTSW 17 68842009 missense probably benign 0.00
R5989:Tmem200c UTSW 17 68837436 start gained probably benign
R6024:Tmem200c UTSW 17 68841727 missense possibly damaging 0.49
R6634:Tmem200c UTSW 17 68842106 missense probably benign 0.26
R7527:Tmem200c UTSW 17 68841676 missense probably benign 0.04
R8046:Tmem200c UTSW 17 68840518 missense probably benign 0.29
R8927:Tmem200c UTSW 17 68841738 missense probably benign 0.00
R8928:Tmem200c UTSW 17 68841738 missense probably benign 0.00
R9185:Tmem200c UTSW 17 68840638 missense probably damaging 1.00
R9241:Tmem200c UTSW 17 68837166 start gained probably benign
R9374:Tmem200c UTSW 17 68841687 missense probably damaging 1.00
Z1176:Tmem200c UTSW 17 68841795 missense probably damaging 0.99
Z1177:Tmem200c UTSW 17 68841337 missense probably benign 0.13
Z1177:Tmem200c UTSW 17 68841344 missense probably benign 0.26
Z1177:Tmem200c UTSW 17 68841436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTCTTTCCATCGCACAAACTGG -3'
(R):5'- AGCTTGTCTGAGTGCAAGTAGCC -3'

Sequencing Primer
(F):5'- AGTTCCATCCAGGGGCAG -3'
(R):5'- ggaggaggaagaggaagagg -3'
Posted On 2013-07-11