Incidental Mutation 'R0599:Plcxd3'
ID 55252
Institutional Source Beutler Lab
Gene Symbol Plcxd3
Ensembl Gene ENSMUSG00000049148
Gene Name phosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms B130016O10Rik
MMRRC Submission 038788-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R0599 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 4404973-4605035 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4546349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 118 (S118G)
Ref Sequence ENSEMBL: ENSMUSP00000053553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061925] [ENSMUST00000130332]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061925
AA Change: S118G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053553
Gene: ENSMUSG00000049148
AA Change: S118G

DomainStartEndE-ValueType
SCOP:d2ptd__ 2 311 2e-62 SMART
PDB:1AOD|A 7 166 1e-8 PDB
Blast:PLCXc 23 148 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130332
Meta Mutation Damage Score 0.1289 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,529,208 (GRCm39) L978P probably damaging Het
Abcb1a C T 5: 8,748,539 (GRCm39) T290M probably benign Het
Abcd3 A T 3: 121,558,742 (GRCm39) F585I probably damaging Het
Abtb3 G A 10: 85,494,200 (GRCm39) G1106D probably damaging Het
Acan A G 7: 78,761,038 (GRCm39) probably benign Het
Anxa6 T C 11: 54,870,292 (GRCm39) D667G possibly damaging Het
Ap3m2 G T 8: 23,283,128 (GRCm39) A208D possibly damaging Het
Arhgap17 A T 7: 122,903,013 (GRCm39) probably benign Het
Bptf A G 11: 106,959,208 (GRCm39) V1838A probably damaging Het
Brip1 T A 11: 86,043,563 (GRCm39) M334L probably benign Het
Btbd10 C T 7: 112,934,516 (GRCm39) probably benign Het
Cdh20 C A 1: 109,980,696 (GRCm39) T208K probably damaging Het
Cnga4 A G 7: 105,055,025 (GRCm39) Y100C probably damaging Het
Dnah10 G A 5: 124,878,017 (GRCm39) V2644M probably damaging Het
Dnah9 T C 11: 65,856,515 (GRCm39) D2882G probably damaging Het
Eapp T A 12: 54,732,747 (GRCm39) K117M probably damaging Het
Eml3 T C 19: 8,916,427 (GRCm39) V673A probably benign Het
Ephb4 G A 5: 137,368,117 (GRCm39) C754Y probably damaging Het
Eps8l1 A G 7: 4,480,956 (GRCm39) D33G possibly damaging Het
Farsa A G 8: 85,594,212 (GRCm39) K321E probably damaging Het
Fry G A 5: 150,360,624 (GRCm39) R2090Q probably damaging Het
Gm10283 A G 8: 60,954,258 (GRCm39) probably benign Het
Grm4 A G 17: 27,650,464 (GRCm39) I844T probably benign Het
Gtf2h3 A G 5: 124,726,691 (GRCm39) D124G probably benign Het
Gulo A T 14: 66,227,890 (GRCm39) D347E probably damaging Het
Hmcn1 A G 1: 150,485,552 (GRCm39) F4350S possibly damaging Het
Hspg2 A G 4: 137,239,712 (GRCm39) D473G probably damaging Het
Il17ra T A 6: 120,458,466 (GRCm39) I539N probably damaging Het
Insrr A G 3: 87,720,440 (GRCm39) E1026G probably damaging Het
Itga2 A T 13: 114,993,186 (GRCm39) probably benign Het
Kdm1b A T 13: 47,212,286 (GRCm39) D190V possibly damaging Het
Lima1 A T 15: 99,700,040 (GRCm39) N146K probably damaging Het
Mnt G T 11: 74,733,122 (GRCm39) V85L probably benign Het
Mon2 T A 10: 122,861,970 (GRCm39) probably benign Het
Mtf1 T C 4: 124,713,994 (GRCm39) probably benign Het
Mylk4 T C 13: 32,896,737 (GRCm39) probably null Het
Myo18b A C 5: 113,013,616 (GRCm39) L780R probably damaging Het
Myo1e A G 9: 70,283,942 (GRCm39) probably benign Het
Obscn A G 11: 58,964,522 (GRCm39) S705P probably damaging Het
Ocrl A T X: 47,024,963 (GRCm39) probably benign Het
Or1e34 A T 11: 73,778,730 (GRCm39) M156K probably benign Het
Or4c35 T C 2: 89,808,545 (GRCm39) F141S probably benign Het
Or51k1 A T 7: 103,661,395 (GRCm39) C171* probably null Het
Or52ab4 A G 7: 102,987,393 (GRCm39) N44S probably damaging Het
Otof T A 5: 30,528,049 (GRCm39) K1931N probably damaging Het
Plcz1 T A 6: 139,974,268 (GRCm39) Q58L probably benign Het
Proser1 C A 3: 53,386,485 (GRCm39) P789Q probably benign Het
Rassf4 T C 6: 116,622,897 (GRCm39) E38G probably damaging Het
Ros1 A T 10: 51,999,396 (GRCm39) Y1164N probably damaging Het
Rpgrip1l A G 8: 92,031,628 (GRCm39) I83T probably damaging Het
Scn9a T G 2: 66,357,143 (GRCm39) K1053Q probably damaging Het
Sgsm1 G T 5: 113,392,894 (GRCm39) Q1087K probably damaging Het
Slc16a10 T C 10: 40,017,914 (GRCm39) D40G probably benign Het
Slc27a6 A G 18: 58,689,885 (GRCm39) D117G probably damaging Het
Slc2a9 T A 5: 38,637,487 (GRCm39) probably benign Het
Slc4a1 A G 11: 102,248,741 (GRCm39) probably benign Het
Smarca1 T A X: 46,912,303 (GRCm39) Q982L probably benign Het
Sp100 T A 1: 85,608,831 (GRCm39) I320N possibly damaging Het
Stx8 A T 11: 68,000,188 (GRCm39) R209S probably null Het
Sulf2 T C 2: 165,925,799 (GRCm39) T453A possibly damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,144,734 (GRCm39) probably null Het
Tenm2 T A 11: 35,915,607 (GRCm39) I1976F possibly damaging Het
Tenm3 G A 8: 48,730,745 (GRCm39) S1341L probably damaging Het
Tmem130 C T 5: 144,674,619 (GRCm39) V369M probably damaging Het
Tmem200c A G 17: 69,147,506 (GRCm39) K30E probably damaging Het
Tmem225 A G 9: 40,061,043 (GRCm39) I117V possibly damaging Het
Tmt1a3 A T 15: 100,233,264 (GRCm39) N152Y possibly damaging Het
Top2a A G 11: 98,892,243 (GRCm39) I1073T probably damaging Het
Trps1 A C 15: 50,695,256 (GRCm39) Y296* probably null Het
Tubg1 T C 11: 101,016,162 (GRCm39) M377T probably benign Het
Tut7 A G 13: 59,957,301 (GRCm39) V7A probably damaging Het
Vmn1r35 G A 6: 66,656,497 (GRCm39) H58Y probably benign Het
Vmn1r56 G A 7: 5,199,429 (GRCm39) H63Y probably benign Het
Vmn1r75 T C 7: 11,615,189 (GRCm39) probably null Het
Vnn3 T C 10: 23,741,603 (GRCm39) S303P possibly damaging Het
Wdr49 C T 3: 75,338,383 (GRCm39) probably null Het
Wdr49 T C 3: 75,357,197 (GRCm39) probably null Het
Zzef1 T C 11: 72,804,004 (GRCm39) L2582P probably damaging Het
Other mutations in Plcxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Plcxd3 APN 15 4,546,122 (GRCm39) missense possibly damaging 0.91
IGL02743:Plcxd3 APN 15 4,604,285 (GRCm39) missense possibly damaging 0.92
IGL03230:Plcxd3 APN 15 4,546,272 (GRCm39) missense probably damaging 0.99
R0724:Plcxd3 UTSW 15 4,546,350 (GRCm39) missense probably damaging 0.99
R0939:Plcxd3 UTSW 15 4,546,344 (GRCm39) nonsense probably null
R1536:Plcxd3 UTSW 15 4,546,093 (GRCm39) splice site probably benign
R1648:Plcxd3 UTSW 15 4,405,291 (GRCm39) missense probably benign
R1858:Plcxd3 UTSW 15 4,546,093 (GRCm39) splice site probably benign
R2418:Plcxd3 UTSW 15 4,604,245 (GRCm39) missense probably benign 0.04
R2419:Plcxd3 UTSW 15 4,604,245 (GRCm39) missense probably benign 0.04
R4640:Plcxd3 UTSW 15 4,546,725 (GRCm39) missense probably damaging 0.99
R4702:Plcxd3 UTSW 15 4,405,269 (GRCm39) missense probably benign
R5372:Plcxd3 UTSW 15 4,604,270 (GRCm39) missense probably benign
R5705:Plcxd3 UTSW 15 4,546,676 (GRCm39) missense probably benign 0.43
R6302:Plcxd3 UTSW 15 4,546,239 (GRCm39) missense probably damaging 1.00
R7050:Plcxd3 UTSW 15 4,546,200 (GRCm39) missense probably damaging 0.96
R7283:Plcxd3 UTSW 15 4,546,401 (GRCm39) missense probably damaging 0.97
R7856:Plcxd3 UTSW 15 4,546,581 (GRCm39) missense probably damaging 0.98
R8233:Plcxd3 UTSW 15 4,546,317 (GRCm39) missense possibly damaging 0.77
R8272:Plcxd3 UTSW 15 4,546,218 (GRCm39) missense probably damaging 0.99
R8782:Plcxd3 UTSW 15 4,546,250 (GRCm39) missense probably benign 0.27
R9517:Plcxd3 UTSW 15 4,405,160 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTTCGGAACTGTAGCCAAGAAG -3'
(R):5'- ATCATCTGTCCAGGCCAGAGGAAG -3'

Sequencing Primer
(F):5'- CTGTAGCCAAGAAGTTGATGC -3'
(R):5'- TCACTTCCTGGGCAAAAATGG -3'
Posted On 2013-07-11