Incidental Mutation 'R7144:Spag17'
ID 574554
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Name sperm associated antigen 17
Synonyms 4931427F14Rik, PF6
MMRRC Submission 045328-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99885406-100143322 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to T at 100027401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
AlphaFold Q5S003
Predicted Effect probably null
Transcript: ENSMUST00000164539
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7126:Spag17 UTSW 3 100101435 missense probably benign 0.00
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100095595 nonsense probably null
R7772:Spag17 UTSW 3 100080118 missense probably damaging 0.98
R7842:Spag17 UTSW 3 100053858 missense probably benign 0.18
R7963:Spag17 UTSW 3 100022638 missense probably benign 0.02
R8168:Spag17 UTSW 3 100034984 missense possibly damaging 0.96
R8291:Spag17 UTSW 3 100060850 missense probably benign
R8347:Spag17 UTSW 3 100027641 missense probably benign
R8383:Spag17 UTSW 3 100085392 missense probably damaging 0.98
R8474:Spag17 UTSW 3 100027270 missense probably benign 0.00
R8528:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R8804:Spag17 UTSW 3 99967190 missense probably benign
R8809:Spag17 UTSW 3 99982422 missense probably benign 0.33
R8818:Spag17 UTSW 3 100013227 missense probably benign 0.02
R8830:Spag17 UTSW 3 100125435 missense possibly damaging 0.77
R8890:Spag17 UTSW 3 100004678 missense possibly damaging 0.73
R9008:Spag17 UTSW 3 100027626 missense possibly damaging 0.73
R9095:Spag17 UTSW 3 100004776 missense possibly damaging 0.86
R9143:Spag17 UTSW 3 100027590 missense probably benign
R9182:Spag17 UTSW 3 100058842 missense possibly damaging 0.92
R9211:Spag17 UTSW 3 100125298 critical splice acceptor site probably benign
R9344:Spag17 UTSW 3 100103477 missense probably benign 0.01
R9354:Spag17 UTSW 3 100027589 missense probably benign
R9527:Spag17 UTSW 3 100063461 missense probably damaging 1.00
R9658:Spag17 UTSW 3 100027616 missense possibly damaging 0.93
R9738:Spag17 UTSW 3 100027210 missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Z1176:Spag17 UTSW 3 100012993 missense probably benign 0.18
Z1177:Spag17 UTSW 3 100088399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATGAAGTAGAACGAGCCTTC -3'
(R):5'- CATCAGGCTCGTCAGAATTTGG -3'

Sequencing Primer
(F):5'- GAACGAGCCTTCAAGGTATTTAC -3'
(R):5'- CGTCAGAATTTGGGGAATTTTCATC -3'
Posted On 2019-09-18