Incidental Mutation 'R7767:Atp10a'
ID598297
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene NameATPase, class V, type 10A
SynonymsAtp10c, pfatp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7767 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location58656166-58829420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 58658849 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Serine at position 132 (W132S)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747] [ENSMUST00000207668]
Predicted Effect probably damaging
Transcript: ENSMUST00000168747
AA Change: W132S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: W132S

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207668
AA Change: W132S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,920,287 probably null Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Arhgef15 T C 11: 68,953,847 E308G probably damaging Het
Asb15 A G 6: 24,559,282 D142G probably benign Het
Atg13 A G 2: 91,679,366 S394P probably damaging Het
BC003331 A G 1: 150,372,037 V387A probably benign Het
Bod1l T A 5: 41,816,756 N2405I probably benign Het
Capsl C T 15: 9,462,684 R137C probably damaging Het
Cd109 T A 9: 78,710,159 M1313K probably damaging Het
Chst13 G A 6: 90,309,584 A132V possibly damaging Het
Cobl T C 11: 12,412,117 probably benign Het
Coq9 A T 8: 94,850,586 E193V probably benign Het
Cpd T A 11: 76,813,559 I410F probably benign Het
Cyth3 T G 5: 143,707,474 V351G probably damaging Het
Dcdc2c T C 12: 28,470,257 K607E Het
Dcp1a T C 14: 30,479,818 probably null Het
Dennd3 A G 15: 73,522,230 I35V probably benign Het
Dlgap4 C T 2: 156,746,053 R606W probably damaging Het
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Erbin A G 13: 103,859,399 L265P probably damaging Het
Ern1 T C 11: 106,400,308 D847G probably damaging Het
Esyt3 T G 9: 99,324,971 S342R probably benign Het
Exoc2 A T 13: 30,876,769 I584K probably benign Het
Fam240a T C 9: 110,915,022 R50G probably damaging Het
Glis3 A T 19: 28,263,960 M858K probably benign Het
Gls2 C T 10: 128,195,129 R86C unknown Het
Gm10972 C A 3: 94,643,594 Y25* probably null Het
H2-T10 A T 17: 36,117,730 M350K probably benign Het
Has1 A T 17: 17,850,530 V43D probably damaging Het
Herc2 T A 7: 56,228,527 S4609R probably benign Het
Hmgcs2 A C 3: 98,291,266 T162P probably damaging Het
Hspg2 G T 4: 137,511,866 C368F probably damaging Het
Ighv11-1 A G 12: 113,982,102 S44P probably damaging Het
Inppl1 A G 7: 101,824,338 V1035A probably benign Het
Kmt2a C T 9: 44,818,998 V3341I unknown Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrriq1 G C 10: 103,215,954 S312R probably damaging Het
Map1a G A 2: 121,302,036 S1111N probably damaging Het
Myo15 T C 11: 60,502,096 V1029A Het
Nol11 T C 11: 107,179,082 H314R possibly damaging Het
Nphs1 A T 7: 30,463,308 D404V probably damaging Het
Olfr550 A T 7: 102,571,764 probably benign Het
Pabpc2 T C 18: 39,774,554 Y291H possibly damaging Het
Pcdh15 G A 10: 74,486,256 A1020T probably benign Het
Pla2g4f A C 2: 120,305,009 S395A possibly damaging Het
Ppp1r18 A G 17: 35,867,284 Q17R probably damaging Het
Prokr2 A T 2: 132,374,076 V155D probably damaging Het
Pwwp2a T G 11: 43,705,869 C620W probably damaging Het
Rabepk T C 2: 34,785,593 D175G probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Rgma C A 7: 73,418,004 L446I unknown Het
Rnf212b T C 14: 54,842,368 S182P probably damaging Het
Rnf6 C A 5: 146,211,176 R344I probably damaging Het
Rnf6 T A 5: 146,211,177 R344* probably null Het
Sgo1 A G 17: 53,679,611 I184T possibly damaging Het
Sgpl1 A T 10: 61,117,723 I78N possibly damaging Het
Snx13 T A 12: 35,107,484 Y510N probably damaging Het
Sptbn2 G A 19: 4,734,143 E638K possibly damaging Het
Sspo A G 6: 48,451,382 T349A probably damaging Het
Sv2c C T 13: 95,989,715 S343N probably damaging Het
Syne1 C A 10: 5,333,560 V1502F possibly damaging Het
Syne1 T A 10: 5,333,632 I1478F possibly damaging Het
Tmem121 C T 12: 113,188,372 A70V probably damaging Het
Tmem215 A G 4: 40,474,042 I40V possibly damaging Het
Trim25 A G 11: 89,009,117 probably null Het
Trio A G 15: 27,889,418 V534A unknown Het
Tyr T A 7: 87,493,010 E114V probably benign Het
Ush2a A T 1: 188,553,260 T1998S probably benign Het
Usp40 G T 1: 87,982,178 A518E probably benign Het
Usp48 T A 4: 137,604,645 probably null Het
Vash1 T A 12: 86,686,993 F152L probably damaging Het
Vsig10l C A 7: 43,463,717 P31Q probably damaging Het
Xab2 C T 8: 3,619,018 E43K probably benign Het
Zfp423 G A 8: 87,780,884 S944F probably damaging Het
Zp2 A T 7: 120,137,169 D350E probably benign Het
Zscan4e T G 7: 11,307,534 Q165P probably damaging Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4260001:Atp10a UTSW 7 58791118 nonsense probably null
PIT4445001:Atp10a UTSW 7 58803467 missense probably damaging 0.98
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2080:Atp10a UTSW 7 58824327 missense probably damaging 0.97
R2424:Atp10a UTSW 7 58794555 missense probably benign 0.16
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R5885:Atp10a UTSW 7 58813800 missense possibly damaging 0.92
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6269:Atp10a UTSW 7 58803739 missense possibly damaging 0.51
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
R7530:Atp10a UTSW 7 58773976 missense probably benign 0.02
R7561:Atp10a UTSW 7 58827133 missense probably damaging 0.98
R7743:Atp10a UTSW 7 58803709 missense probably damaging 1.00
R7861:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7903:Atp10a UTSW 7 58658822 missense probably damaging 1.00
R8015:Atp10a UTSW 7 58803497 missense probably benign 0.00
R8166:Atp10a UTSW 7 58807522 missense possibly damaging 0.46
R8201:Atp10a UTSW 7 58819676 nonsense probably null
R8465:Atp10a UTSW 7 58828310 missense probably benign 0.32
Z1176:Atp10a UTSW 7 58788447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTACACGCTGCTGTCCTTC -3'
(R):5'- ATGTGGATGAAACTAAACACGTGC -3'

Sequencing Primer
(F):5'- CTTGCCCAAGAATCTCTTCGAG -3'
(R):5'- CCCCTGCATCTTTGAGGATGAATG -3'
Posted On2019-11-26