Mutagenetix > Incidental Mutation

Incidental Mutation 'R7474:Atp10a'

579338

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R7474 (G1)

Quality Score

152.008

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58658527 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 25 (E25K)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747] [ENSMUST00000207668]

AlphaFold

O54827

Predicted Effect

unknown
Transcript: ENSMUST00000168747
AA Change: E25K

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: E25K

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000207668
AA Change: E25K

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,328,088	C3089*	probably null	Het
Abcc1	A	G	16: 14,472,986	T1487A	possibly damaging	Het
Agfg1	T	A	1: 82,882,411	L333*	probably null	Het
Agfg2	C	A	5: 137,653,868	V410F	possibly damaging	Het
Amotl2	T	C	9: 102,730,111	V706A	probably benign	Het
Apob	A	T	12: 8,009,185	T2556S	probably benign	Het
Asb18	T	A	1: 89,993,033	H174L	possibly damaging	Het
Aup1	T	C	6: 83,054,967	L65P	probably benign	Het
Blvra	T	C	2: 127,086,849	F86L	probably damaging	Het
Cabp4	T	C	19: 4,139,399	D53G	probably benign	Het
Cd300c2	T	A	11: 114,998,296	E153V	probably benign	Het
Crxos	A	G	7: 15,902,931	E143G	possibly damaging	Het
Csmd2	A	G	4: 128,546,127	N3125D		Het
Cyp2c67	T	A	19: 39,617,432	Q340L	probably null	Het
Dscam	T	A	16: 96,819,889	N540Y	possibly damaging	Het
E2f8	G	A	7: 48,875,760	R155W	probably damaging	Het
Ext1	A	T	15: 53,344,489	V292D	probably damaging	Het
Extl3	T	C	14: 65,076,641	E364G	possibly damaging	Het
Fmn2	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	1: 174,609,203		probably benign	Het
Fsd1	A	T	17: 55,988,149	D46V	possibly damaging	Het
Gcnt2	T	A	13: 40,958,257	L374H	probably damaging	Het
Gm10309	G	A	17: 86,504,667		probably benign	Het
Gm13084	T	C	4: 143,811,699	D234G	probably benign	Het
Gm14410	A	T	2: 177,202,825		probably null	Het
Gm5114	A	T	7: 39,407,980	S738R	probably benign	Het
Gtf3c2	C	A	5: 31,167,756	G502W	probably damaging	Het
Insc	G	A	7: 114,768,823		probably null	Het
Kcnt2	T	C	1: 140,570,478	Y898H	possibly damaging	Het
Kctd19	C	A	8: 105,392,032	R299L	probably benign	Het
Klf10	T	C	15: 38,297,202	N198S	probably benign	Het
L3mbtl1	A	T	2: 162,966,604	D574V	probably damaging	Het
Lamc1	G	A	1: 153,332,265	A92V	possibly damaging	Het
Lrrc63	T	A	14: 75,126,203	T163S	possibly damaging	Het
Mak	T	A	13: 41,051,480	K127N	probably damaging	Het
Mdga2	G	A	12: 66,486,761	Q945*	probably null	Het
Mthfr	T	A	4: 148,052,602	I519N	possibly damaging	Het
Mtmr2	C	A	9: 13,799,225	H357N	probably damaging	Het
Myh13	A	T	11: 67,327,164	E21V	possibly damaging	Het
Myh13	A	C	11: 67,367,711	Q184P		Het
Nans	T	A	4: 46,502,484	L307Q	probably damaging	Het
Ncan	C	A	8: 70,102,041	R1042L	possibly damaging	Het
Nrg3	T	C	14: 39,011,999	E310G	probably damaging	Het
Obsl1	A	C	1: 75,498,184	N857K	probably benign	Het
Olfml2a	T	C	2: 38,960,261	V663A	probably damaging	Het
Olfr1104	T	C	2: 87,022,554		probably benign	Het
Olfr116	T	C	17: 37,624,386	D83G	probably benign	Het
Olfr213	G	T	6: 116,541,038	C195F	probably damaging	Het
Olfr603	A	G	7: 103,383,762	I80T	probably damaging	Het
Olfr621-ps1	C	A	7: 103,629,147	W271L	unknown	Het
Pla2g4a	T	C	1: 149,865,200	M363V	possibly damaging	Het
Prickle1	A	T	15: 93,508,671	V157D	possibly damaging	Het
Pstk	A	G	7: 131,373,633	N105S	probably benign	Het
Ptpn21	A	G	12: 98,737,363		probably null	Het
Rnf2	T	A	1: 151,471,716	E277D	probably benign	Het
Rnpepl1	T	C	1: 92,918,972	F532S	probably benign	Het
Rtn1	C	T	12: 72,308,390	A261T	possibly damaging	Het
Ryr2	A	G	13: 11,594,876	S4355P	probably benign	Het
Sacs	T	G	14: 61,211,178	L3558V	probably benign	Het
Senp6	T	C	9: 80,142,328	V1047A	probably damaging	Het
Slco2b1	A	T	7: 99,664,832	C515S	probably damaging	Het
Smgc	T	A	15: 91,860,694	V732E	possibly damaging	Het
Sorcs1	T	C	19: 50,153,112	M1105V	possibly damaging	Het
Spats1	A	G	17: 45,457,161	Y160H	possibly damaging	Het
Tnfsf14	T	A	17: 57,190,848	D128V		Het
Tns3	T	C	11: 8,530,894	Q234R	probably damaging	Het
Uxs1	A	G	1: 43,757,024	V306A	possibly damaging	Het
Vac14	T	A	8: 110,636,434	V304D	probably damaging	Het
Vangl1	A	G	3: 102,184,249	F174L	probably benign	Het
Vav1	A	G	17: 57,299,102	E242G	probably benign	Het
Vsir	A	G	10: 60,368,922	N305D	probably benign	Het
Vwce	T	A	19: 10,646,941	C399S	possibly damaging	Het
Wrn	A	T	8: 33,329,181	L248M	probably damaging	Het
Zfp141	T	A	7: 42,476,254	K265*	probably null	Het
Zfp735	A	T	11: 73,711,176	K315N	possibly damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
R8858:Atp10a	UTSW	7	58816223	missense	probably damaging	1.00
R8985:Atp10a	UTSW	7	58788344	missense	probably benign	0.03
R9003:Atp10a	UTSW	7	58807455	missense	probably damaging	1.00
R9274:Atp10a	UTSW	7	58828621	missense	probably benign	0.22
R9385:Atp10a	UTSW	7	58828139	missense	probably benign	0.00
R9432:Atp10a	UTSW	7	58819670	missense	possibly damaging	0.95
R9454:Atp10a	UTSW	7	58658591	missense	probably benign
R9596:Atp10a	UTSW	7	58827805	missense	probably damaging	1.00
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTAGTAGACCTGGAAGTCTGGACAG -3'
(R):5'- TCTTGGGCAAGAAGGACAGC -3'

Sequencing Primer
(F):5'- TGGAAGTCTGGACAGGCTGC -3'
(R):5'- ACAGCAGCGTGTACTTGG -3'

Posted On

2019-10-07