Incidental Mutation 'R6956:Fam229b'
ID557065
Institutional Source Beutler Lab
Gene Symbol Fam229b
Ensembl Gene ENSMUSG00000051736
Gene Namefamily with sequence similarity 229, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6956 (G1)
Quality Score57.0073
Status Validated
Chromosome10
Chromosomal Location39118804-39133914 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to A at 39133847 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019991] [ENSMUST00000063204] [ENSMUST00000124941] [ENSMUST00000125042] [ENSMUST00000134279] [ENSMUST00000135785] [ENSMUST00000139743] [ENSMUST00000149949] [ENSMUST00000213459]
Predicted Effect probably benign
Transcript: ENSMUST00000019991
SMART Domains Protein: ENSMUSP00000019991
Gene: ENSMUSG00000019845

DomainStartEndE-ValueType
Tubulin 55 277 1.08e-38 SMART
Tubulin_C 279 414 9.81e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000063204
SMART Domains Protein: ENSMUSP00000063508
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124941
SMART Domains Protein: ENSMUSP00000123540
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125042
SMART Domains Protein: ENSMUSP00000121708
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 48 3.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134279
SMART Domains Protein: ENSMUSP00000118858
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135785
SMART Domains Protein: ENSMUSP00000118928
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139743
SMART Domains Protein: ENSMUSP00000118545
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 3 80 4.6e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149949
SMART Domains Protein: ENSMUSP00000121946
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213459
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Fam229b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1511:Fam229b UTSW 10 39118919 makesense probably null
R6014:Fam229b UTSW 10 39118993 missense probably damaging 1.00
X0026:Fam229b UTSW 10 39120267 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTTGTTCCCAGATAAGCC -3'
(R):5'- TAGCTTTCGAGCTCAACGAC -3'

Sequencing Primer
(F):5'- GTTCCCAGATAAGCCTATTTGTCTG -3'
(R):5'- GAGCTCAACGACGCCCTAC -3'
Posted On2019-06-07